Incidental Mutation 'R2225:Adcy10'
ID 239650
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 040226-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R2225 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 165345829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 293 (T293A)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: T293A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: T293A

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: T293A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: T293A

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: T293A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: T293A

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148550
AA Change: T293A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: T293A

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Meta Mutation Damage Score 0.5700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,813,349 (GRCm39) L439R probably damaging Het
Aen C A 7: 78,552,199 (GRCm39) T15K probably benign Het
Aggf1 A G 13: 95,507,354 (GRCm39) S144P probably damaging Het
Akap9 A T 5: 4,127,271 (GRCm39) R3706S probably damaging Het
Btd A G 14: 31,389,017 (GRCm39) D246G probably benign Het
Ccdc33 A G 9: 57,989,305 (GRCm39) S123P probably damaging Het
Cep152 T C 2: 125,423,704 (GRCm39) E899G probably damaging Het
Cpsf6 A T 10: 117,198,941 (GRCm39) probably benign Het
Crybg3 A G 16: 59,375,041 (GRCm39) I2071T probably damaging Het
Cwc22 T A 2: 77,738,495 (GRCm39) probably benign Het
Ddah2 T A 17: 35,279,187 (GRCm39) I16N probably damaging Het
Dld T G 12: 31,391,448 (GRCm39) M123L probably benign Het
Eif5b A T 1: 38,058,304 (GRCm39) K202I unknown Het
Gm6430 T C 1: 96,953,441 (GRCm39) noncoding transcript Het
Hdac9 C T 12: 34,457,801 (GRCm39) V251I probably benign Het
Hoxa10 T C 6: 52,209,616 (GRCm39) E52G probably damaging Het
Hspa4 C T 11: 53,177,760 (GRCm39) V117M probably benign Het
Htra4 T C 8: 25,515,736 (GRCm39) D434G probably benign Het
Itgb3 A G 11: 104,556,336 (GRCm39) M726V probably benign Het
Itih1 A G 14: 30,651,534 (GRCm39) V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,217,564 (GRCm39) probably null Het
Kpna1 G A 16: 35,851,591 (GRCm39) A392T probably damaging Het
Limk1 G T 5: 134,690,410 (GRCm39) probably null Het
Lonrf1 T C 8: 36,703,252 (GRCm39) D308G probably damaging Het
Muc4 A T 16: 32,576,265 (GRCm39) probably benign Het
Muc4 G A 16: 32,587,316 (GRCm39) C2719Y possibly damaging Het
Mvb12b G A 2: 33,730,211 (GRCm39) T60I possibly damaging Het
Myh2 C T 11: 67,084,555 (GRCm39) T1698M probably benign Het
Naalad2 A T 9: 18,287,829 (GRCm39) V267E possibly damaging Het
Nkpd1 A T 7: 19,253,745 (GRCm39) Y37F probably benign Het
Or10d5 T C 9: 39,861,833 (GRCm39) K78R possibly damaging Het
Or2l5 T C 16: 19,333,996 (GRCm39) H130R probably benign Het
Or8g33 T C 9: 39,337,915 (GRCm39) I151V probably benign Het
Plekhg2 G A 7: 28,059,760 (GRCm39) P1190S probably benign Het
Reck A G 4: 43,922,837 (GRCm39) T371A probably benign Het
Rnf185 T C 11: 3,382,445 (GRCm39) D44G probably damaging Het
Rpgrip1l T C 8: 91,948,095 (GRCm39) E1196G probably benign Het
Rundc1 A G 11: 101,322,170 (GRCm39) probably benign Het
Sf3b3 T C 8: 111,541,205 (GRCm39) Y970C probably damaging Het
Sfxn1 A G 13: 54,239,536 (GRCm39) T20A possibly damaging Het
Shprh T C 10: 11,037,979 (GRCm39) probably benign Het
Spata31d1a T A 13: 59,851,529 (GRCm39) I200L probably benign Het
Srsf6 G A 2: 162,773,619 (GRCm39) S10N probably damaging Het
Tbxa2r A G 10: 81,168,983 (GRCm39) Y224C probably benign Het
Tlr5 A G 1: 182,799,941 (GRCm39) probably benign Het
Tmem270 A G 5: 134,935,492 (GRCm39) L21P probably damaging Het
Tmtc2 T C 10: 105,206,218 (GRCm39) E359G probably benign Het
Tnn A T 1: 159,975,035 (GRCm39) C131S probably damaging Het
Tnnt2 A G 1: 135,771,529 (GRCm39) probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tph1 A G 7: 46,314,598 (GRCm39) probably null Het
Wiz C T 17: 32,575,899 (GRCm39) V836M probably damaging Het
Zfp451 T A 1: 33,809,988 (GRCm39) probably benign Het
Zfp738 A G 13: 67,818,431 (GRCm39) F520S probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGTGACTTGTGCCTCACAC -3'
(R):5'- TCCTTGGACTCAGTGCTAACC -3'

Sequencing Primer
(F):5'- CACACTGAGATAGCTTCAGTTGCTG -3'
(R):5'- GTGCTAACCTTACACTACGGG -3'
Posted On 2014-10-15