Incidental Mutation 'R2225:Tph1'
ID239665
Institutional Source Beutler Lab
Gene Symbol Tph1
Ensembl Gene ENSMUSG00000040046
Gene Nametryptophan hydroxylase 1
Synonyms
MMRRC Submission 040226-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R2225 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46644641-46672537 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 46665174 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049298] [ENSMUST00000049298] [ENSMUST00000107669] [ENSMUST00000107669] [ENSMUST00000168335] [ENSMUST00000168335] [ENSMUST00000170251] [ENSMUST00000170251]
Predicted Effect probably null
Transcript: ENSMUST00000049298
SMART Domains Protein: ENSMUSP00000037752
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 4.3e-8 PFAM
Pfam:Biopterin_H 109 440 4.7e-188 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000049298
SMART Domains Protein: ENSMUSP00000037752
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 4.3e-8 PFAM
Pfam:Biopterin_H 109 440 4.7e-188 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107669
SMART Domains Protein: ENSMUSP00000103296
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:Biopterin_H 109 439 7.6e-176 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107669
SMART Domains Protein: ENSMUSP00000103296
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:Biopterin_H 109 439 7.6e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163468
Predicted Effect probably null
Transcript: ENSMUST00000168335
SMART Domains Protein: ENSMUSP00000128107
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 3.7e-9 PFAM
Pfam:Biopterin_H 109 149 1.8e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168335
SMART Domains Protein: ENSMUSP00000128107
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 3.7e-9 PFAM
Pfam:Biopterin_H 109 149 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170045
Predicted Effect probably benign
Transcript: ENSMUST00000170251
SMART Domains Protein: ENSMUSP00000132489
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 6.7e-8 PFAM
Pfam:Biopterin_H 109 279 3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170251
SMART Domains Protein: ENSMUSP00000132489
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 6.7e-8 PFAM
Pfam:Biopterin_H 109 279 3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172386
SMART Domains Protein: ENSMUSP00000128727
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 17 82 6.9e-9 PFAM
Pfam:Biopterin_H 105 164 8.9e-24 PFAM
low complexity region 175 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172386
SMART Domains Protein: ENSMUSP00000128727
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 17 82 6.9e-9 PFAM
Pfam:Biopterin_H 105 164 8.9e-24 PFAM
low complexity region 175 188 N/A INTRINSIC
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase family. The encoded protein is one of two tryptophan hydroxylase enzymes that catalyze the first and rate limiting step in the biosynthesis of the hormone and neurotransmitter, serotonin. This gene is expressed in peripheral organs, while tryptophan hydroxylase 2 is expressed in neurons. The encoded protein is involved in the development of hypoxia-induced elevations in pulmonary pressures and pulmonary vascular remodeling, and has also been implicated as a regulator of immune tolerance. Disruption of this gene is associated with cardiac dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one null allele display no gross behavioral abnormalities. Mice homozygous for a second null allele display fatigue, breathing difficulties, progressive pallor, and impaired cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Akap9 A T 5: 4,077,271 R3706S probably damaging Het
Btd A G 14: 31,667,060 D246G probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep152 T C 2: 125,581,784 E899G probably damaging Het
Cpsf6 A T 10: 117,363,036 probably benign Het
Crybg3 A G 16: 59,554,678 I2071T probably damaging Het
Cwc22 T A 2: 77,908,151 probably benign Het
Ddah2 T A 17: 35,060,211 I16N probably damaging Het
Dld T G 12: 31,341,449 M123L probably benign Het
Eif5b A T 1: 38,019,223 K202I unknown Het
Gm6430 T C 1: 97,025,716 noncoding transcript Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Hspa4 C T 11: 53,286,933 V117M probably benign Het
Htra4 T C 8: 25,025,720 D434G probably benign Het
Itgb3 A G 11: 104,665,510 M726V probably benign Het
Itih1 A G 14: 30,929,577 V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Limk1 G T 5: 134,661,556 probably null Het
Lonrf1 T C 8: 36,236,098 D308G probably damaging Het
Muc4 A T 16: 32,755,891 probably benign Het
Muc4 G A 16: 32,766,942 C2719Y possibly damaging Het
Mvb12b G A 2: 33,840,199 T60I possibly damaging Het
Myh2 C T 11: 67,193,729 T1698M probably benign Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr952 T C 9: 39,426,619 I151V probably benign Het
Olfr975 T C 9: 39,950,537 K78R possibly damaging Het
Plekhg2 G A 7: 28,360,335 P1190S probably benign Het
Reck A G 4: 43,922,837 T371A probably benign Het
Rnf185 T C 11: 3,432,445 D44G probably damaging Het
Rpgrip1l T C 8: 91,221,467 E1196G probably benign Het
Rundc1 A G 11: 101,431,344 probably benign Het
Sf3b3 T C 8: 110,814,573 Y970C probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Shprh T C 10: 11,162,235 probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tbxa2r A G 10: 81,333,149 Y224C probably benign Het
Tlr5 A G 1: 182,972,376 probably benign Het
Tmem270 A G 5: 134,906,638 L21P probably damaging Het
Tmtc2 T C 10: 105,370,357 E359G probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Wiz C T 17: 32,356,925 V836M probably damaging Het
Zfp451 T A 1: 33,770,907 probably benign Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Tph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Tph1 APN 7 46656870 missense probably benign 0.02
IGL01318:Tph1 APN 7 46665238 missense probably damaging 0.99
IGL01538:Tph1 APN 7 46653753 missense probably damaging 1.00
IGL01564:Tph1 APN 7 46650881 splice site probably benign
IGL02021:Tph1 APN 7 46656997 missense possibly damaging 0.55
IGL02202:Tph1 APN 7 46653761 missense probably benign 0.40
IGL03072:Tph1 APN 7 46652859 missense probably damaging 0.99
I1329:Tph1 UTSW 7 46650013 missense probably damaging 0.99
R0166:Tph1 UTSW 7 46647596 missense probably damaging 1.00
R0433:Tph1 UTSW 7 46653821 missense probably damaging 1.00
R0485:Tph1 UTSW 7 46650024 missense probably benign 0.00
R0501:Tph1 UTSW 7 46649988 nonsense probably null
R1456:Tph1 UTSW 7 46647483 nonsense probably null
R1474:Tph1 UTSW 7 46653862 missense probably benign 0.00
R1846:Tph1 UTSW 7 46660439 missense probably damaging 0.98
R1967:Tph1 UTSW 7 46662114 missense probably benign 0.30
R2102:Tph1 UTSW 7 46660410 splice site probably null
R2176:Tph1 UTSW 7 46662039 missense possibly damaging 0.91
R4773:Tph1 UTSW 7 46656952 missense probably damaging 1.00
R4914:Tph1 UTSW 7 46653859 missense probably damaging 1.00
R5590:Tph1 UTSW 7 46653792 missense probably damaging 1.00
R5622:Tph1 UTSW 7 46647545 nonsense probably null
R5960:Tph1 UTSW 7 46662005 critical splice donor site probably null
R5985:Tph1 UTSW 7 46653781 missense probably damaging 1.00
R6362:Tph1 UTSW 7 46647443 missense possibly damaging 0.94
R7151:Tph1 UTSW 7 46662117 missense possibly damaging 0.93
R7329:Tph1 UTSW 7 46656861 splice site probably null
R7395:Tph1 UTSW 7 46657203 splice site probably null
R8012:Tph1 UTSW 7 46656879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCCATTTCTCAGAGCTGAAC -3'
(R):5'- TGGCCAGTTCTGTGCTTAGC -3'

Sequencing Primer
(F):5'- GCTGGAATCTGAACCTGTGTCC -3'
(R):5'- TGCTTAGCACTCATTTATCTGAAC -3'
Posted On2014-10-15