Incidental Mutation 'R0184:Olfr656'
ID23967
Institutional Source Beutler Lab
Gene Symbol Olfr656
Ensembl Gene ENSMUSG00000073924
Gene Nameolfactory receptor 656
SynonymsGA_x6K02T2PBJ9-7245486-7246451, MOR27-1
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0184 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location104613955-104621603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104618240 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 187 (V187A)
Ref Sequence ENSEMBL: ENSMUSP00000149625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098172] [ENSMUST00000215575]
Predicted Effect probably damaging
Transcript: ENSMUST00000098172
AA Change: V195A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095774
Gene: ENSMUSG00000073924
AA Change: V195A

DomainStartEndE-ValueType
Pfam:7tm_4 41 319 5.2e-105 PFAM
Pfam:7TM_GPCR_Srsx 42 316 1.1e-8 PFAM
Pfam:7tm_1 51 302 4.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210687
AA Change: V187A
Predicted Effect probably damaging
Transcript: ENSMUST00000215575
AA Change: V187A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Olfr656
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Olfr656 APN 7 104617721 missense probably damaging 0.98
IGL01908:Olfr656 APN 7 104617699 missense probably damaging 1.00
IGL02695:Olfr656 APN 7 104618471 missense probably damaging 1.00
IGL03055:Olfr656 UTSW 7 104618206 missense probably damaging 1.00
R0128:Olfr656 UTSW 7 104618581 missense probably damaging 1.00
R4674:Olfr656 UTSW 7 104618424 nonsense probably null
R4675:Olfr656 UTSW 7 104618424 nonsense probably null
R4723:Olfr656 UTSW 7 104618489 missense possibly damaging 0.56
R4979:Olfr656 UTSW 7 104618605 missense probably null 0.03
R6273:Olfr656 UTSW 7 104617895 missense probably damaging 1.00
R6359:Olfr656 UTSW 7 104618303 missense probably damaging 1.00
R6582:Olfr656 UTSW 7 104618441 missense probably damaging 1.00
R6750:Olfr656 UTSW 7 104618113 missense probably damaging 0.99
R7426:Olfr656 UTSW 7 104617852 missense probably damaging 1.00
R7786:Olfr656 UTSW 7 104617718 missense probably benign 0.02
R8068:Olfr656 UTSW 7 104618253 nonsense probably null
X0065:Olfr656 UTSW 7 104617758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTTGCATGATGGAGTCCACAG -3'
(R):5'- ACCTTGGCAACCCTTTCACGAATC -3'

Sequencing Primer
(F):5'- ATGTGGCTATCTGCCATCC -3'
(R):5'- TGACTCCATATACCACAGGGTTAAG -3'
Posted On2013-04-16