Incidental Mutation 'R2225:Ccdc33'
ID 239678
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
MMRRC Submission 040226-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2225 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 58028677-58118823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58082022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 123 (S123P)
Ref Sequence ENSEMBL: ENSMUSP00000112613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000128021] [ENSMUST00000136154] [ENSMUST00000215944]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042205
AA Change: S123P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: S123P

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098682
AA Change: S368P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: S368P

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119665
AA Change: S123P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: S123P

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123746
Predicted Effect probably benign
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136154
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151404
Predicted Effect possibly damaging
Transcript: ENSMUST00000215944
AA Change: S368P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.2635 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Akap9 A T 5: 4,077,271 R3706S probably damaging Het
Btd A G 14: 31,667,060 D246G probably benign Het
Cep152 T C 2: 125,581,784 E899G probably damaging Het
Cpsf6 A T 10: 117,363,036 probably benign Het
Crybg3 A G 16: 59,554,678 I2071T probably damaging Het
Cwc22 T A 2: 77,908,151 probably benign Het
Ddah2 T A 17: 35,060,211 I16N probably damaging Het
Dld T G 12: 31,341,449 M123L probably benign Het
Eif5b A T 1: 38,019,223 K202I unknown Het
Gm6430 T C 1: 97,025,716 noncoding transcript Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Hspa4 C T 11: 53,286,933 V117M probably benign Het
Htra4 T C 8: 25,025,720 D434G probably benign Het
Itgb3 A G 11: 104,665,510 M726V probably benign Het
Itih1 A G 14: 30,929,577 V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Limk1 G T 5: 134,661,556 probably null Het
Lonrf1 T C 8: 36,236,098 D308G probably damaging Het
Muc4 G A 16: 32,766,942 C2719Y possibly damaging Het
Muc4 A T 16: 32,755,891 probably benign Het
Mvb12b G A 2: 33,840,199 T60I possibly damaging Het
Myh2 C T 11: 67,193,729 T1698M probably benign Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr952 T C 9: 39,426,619 I151V probably benign Het
Olfr975 T C 9: 39,950,537 K78R possibly damaging Het
Plekhg2 G A 7: 28,360,335 P1190S probably benign Het
Reck A G 4: 43,922,837 T371A probably benign Het
Rnf185 T C 11: 3,432,445 D44G probably damaging Het
Rpgrip1l T C 8: 91,221,467 E1196G probably benign Het
Rundc1 A G 11: 101,431,344 probably benign Het
Sf3b3 T C 8: 110,814,573 Y970C probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Shprh T C 10: 11,162,235 probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tbxa2r A G 10: 81,333,149 Y224C probably benign Het
Tlr5 A G 1: 182,972,376 probably benign Het
Tmem270 A G 5: 134,906,638 L21P probably damaging Het
Tmtc2 T C 10: 105,370,357 E359G probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 A G 7: 46,665,174 probably null Het
Wiz C T 17: 32,356,925 V836M probably damaging Het
Zfp451 T A 1: 33,770,907 probably benign Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 splice site probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 58069091 missense probably benign
R8215:Ccdc33 UTSW 9 58032712 missense probably benign 0.18
R9139:Ccdc33 UTSW 9 58076559 missense probably benign 0.04
R9204:Ccdc33 UTSW 9 58031105 missense probably benign 0.33
R9280:Ccdc33 UTSW 9 58058266 missense probably benign
R9297:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9318:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58117625 missense possibly damaging 0.96
RF003:Ccdc33 UTSW 9 58058291 missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58117416 missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58118585 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TACTCCACATCTCTGGCTTGGG -3'
(R):5'- CACCAGAAAAGAGTGTTACAATGC -3'

Sequencing Primer
(F):5'- CTTGGGAGGAGCATCACCTAGAC -3'
(R):5'- TGCTAAGAAAATAGCTGCACAG -3'
Posted On 2014-10-15