Incidental Mutation 'R0184:Itgam'
ID 23968
Institutional Source Beutler Lab
Gene Symbol Itgam
Ensembl Gene ENSMUSG00000030786
Gene Name integrin alpha M
Synonyms Mac-1, complement receptor type 3, Ly-40, Mac-1 alpha, CD11B (p170), Cd11b, Mac-1a, CD11b/CD18, complement component receptor 3 alpha, F730045J24Rik, CR3
MMRRC Submission 038449-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R0184 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 127661812-127717663 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127685230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 448 (I448F)
Ref Sequence ENSEMBL: ENSMUSP00000113957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064821
AA Change: I448F

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: I448F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098015
AA Change: I448F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: I448F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106240
AA Change: I448F

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: I448F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106242
AA Change: I448F

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: I448F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120355
AA Change: I448F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: I448F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,212,899 (GRCm39) V131F probably damaging Het
Adam28 T C 14: 68,874,822 (GRCm39) D285G probably benign Het
Akr1c13 A G 13: 4,244,055 (GRCm39) E36G probably damaging Het
Antxr2 A G 5: 98,127,889 (GRCm39) L214S probably damaging Het
Arhgap26 T A 18: 38,750,726 (GRCm39) D46E unknown Het
Armc9 T C 1: 86,126,092 (GRCm39) L61P probably damaging Het
Bicc1 C A 10: 70,915,045 (GRCm39) R73L probably benign Het
Calm2 T C 17: 87,743,269 (GRCm39) N43S probably benign Het
Cct7 A G 6: 85,438,536 (GRCm39) D105G probably null Het
Cdk18 T C 1: 132,046,276 (GRCm39) N215D probably benign Het
Cep126 T C 9: 8,103,396 (GRCm39) T205A probably benign Het
Cfap57 A T 4: 118,456,209 (GRCm39) I495N probably damaging Het
Cyp2b9 T A 7: 25,886,432 (GRCm39) C152* probably null Het
Dab2ip G A 2: 35,608,803 (GRCm39) R579H probably damaging Het
Dnah8 T C 17: 30,902,657 (GRCm39) V905A probably benign Het
Eif4h C A 5: 134,654,229 (GRCm39) D134Y possibly damaging Het
Espl1 T A 15: 102,207,651 (GRCm39) S372T probably benign Het
Fat2 T A 11: 55,187,114 (GRCm39) H1244L probably damaging Het
Fbxo11 T A 17: 88,316,101 (GRCm39) N443I probably benign Het
Git2 G A 5: 114,877,098 (GRCm39) T128M possibly damaging Het
Gm10985 T A 3: 53,752,679 (GRCm39) Y21N probably damaging Het
Gm12790 A T 4: 101,824,811 (GRCm39) Y152* probably null Het
Heatr5a T C 12: 51,956,752 (GRCm39) D1115G probably benign Het
Hipk2 T C 6: 38,695,866 (GRCm39) N726S possibly damaging Het
Hrg T C 16: 22,772,521 (GRCm39) probably null Het
Iars1 T G 13: 49,875,688 (GRCm39) S792A probably benign Het
Igf1r A G 7: 67,875,941 (GRCm39) N1301S possibly damaging Het
Il22 A T 10: 118,041,511 (GRCm39) I75F probably damaging Het
Ilkap T C 1: 91,304,027 (GRCm39) probably benign Het
Ints13 A T 6: 146,456,542 (GRCm39) Y435N probably benign Het
Ints8 A C 4: 11,218,637 (GRCm39) S797A probably benign Het
Itgad T A 7: 127,788,403 (GRCm39) D405E probably benign Het
Klk1 C T 7: 43,878,173 (GRCm39) T41I possibly damaging Het
Mcrip1 T C 11: 120,435,710 (GRCm39) M1V probably null Het
Mdga1 A G 17: 30,071,416 (GRCm39) Y128H probably damaging Het
Mtor G T 4: 148,549,428 (GRCm39) R604L probably benign Het
Or52p1 T C 7: 104,267,447 (GRCm39) V187A probably damaging Het
Or5d41 A T 2: 88,055,124 (GRCm39) L84* probably null Het
Pcdhb7 T A 18: 37,476,443 (GRCm39) D526E probably benign Het
Pip4k2a T C 2: 18,893,939 (GRCm39) D139G probably damaging Het
Pkp3 A C 7: 140,668,280 (GRCm39) N536T probably benign Het
Pla2g4c T A 7: 13,090,145 (GRCm39) S524T probably benign Het
Pno1 T C 11: 17,161,127 (GRCm39) E69G probably benign Het
Pold1 C T 7: 44,191,139 (GRCm39) V231M probably benign Het
Poli A G 18: 70,655,802 (GRCm39) S248P probably damaging Het
Ppox C T 1: 171,107,126 (GRCm39) S138N probably damaging Het
Psg20 T C 7: 18,419,901 (GRCm39) E6G probably null Het
Rbmx C T X: 56,436,926 (GRCm39) probably null Het
Rln1 T A 19: 29,309,336 (GRCm39) K148* probably null Het
Rnf213 C T 11: 119,305,347 (GRCm39) T526I probably damaging Het
Rps6kc1 A T 1: 190,531,290 (GRCm39) V904E probably null Het
Sf3b2 T A 19: 5,333,700 (GRCm39) I633F probably damaging Het
Sfswap T A 5: 129,584,253 (GRCm39) I189N probably damaging Het
Smarca2 T A 19: 26,669,649 (GRCm39) Y973* probably null Het
Spink5 G A 18: 44,136,265 (GRCm39) D559N probably benign Het
Spty2d1 C T 7: 46,647,322 (GRCm39) V536I possibly damaging Het
Tbx3 T C 5: 119,813,627 (GRCm39) I221T probably damaging Het
Tcf20 T A 15: 82,736,501 (GRCm39) D1650V probably damaging Het
Thsd7b A G 1: 129,358,701 (GRCm39) K45R probably benign Het
Tirap A G 9: 35,100,490 (GRCm39) S65P probably benign Het
Trim25 C T 11: 88,890,466 (GRCm39) P51L probably damaging Het
Trim61 T C 8: 65,467,069 (GRCm39) N64S probably benign Het
Twf1 T A 15: 94,478,948 (GRCm39) probably null Het
Ubr4 A C 4: 139,172,573 (GRCm39) T1692P probably damaging Het
Usp3 A G 9: 66,469,863 (GRCm39) M86T probably damaging Het
Utrn T C 10: 12,543,362 (GRCm39) D1762G probably benign Het
V1rd19 T A 7: 23,702,632 (GRCm39) F33I probably benign Het
Vmn2r52 T C 7: 9,893,265 (GRCm39) S625G probably damaging Het
Vmn2r90 G A 17: 17,947,139 (GRCm39) W472* probably null Het
Vrk2 C A 11: 26,500,046 (GRCm39) A56S probably damaging Het
Yeats2 C T 16: 20,022,435 (GRCm39) P620S possibly damaging Het
Zbtb21 C T 16: 97,751,713 (GRCm39) D171N probably damaging Het
Zeb1 A T 18: 5,766,808 (GRCm39) I440F probably damaging Het
Zfp292 A G 4: 34,819,563 (GRCm39) I253T probably damaging Het
Other mutations in Itgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Itgam APN 7 127,684,833 (GRCm39) missense probably damaging 1.00
IGL00983:Itgam APN 7 127,667,839 (GRCm39) missense probably damaging 0.97
IGL01102:Itgam APN 7 127,679,445 (GRCm39) missense possibly damaging 0.94
IGL01615:Itgam APN 7 127,715,939 (GRCm39) missense possibly damaging 0.80
IGL01845:Itgam APN 7 127,711,644 (GRCm39) missense probably damaging 1.00
IGL01860:Itgam APN 7 127,670,115 (GRCm39) missense probably benign 0.03
IGL01874:Itgam APN 7 127,714,338 (GRCm39) missense probably damaging 0.97
IGL01910:Itgam APN 7 127,682,948 (GRCm39) missense probably damaging 1.00
IGL01994:Itgam APN 7 127,700,899 (GRCm39) missense probably damaging 0.97
IGL02332:Itgam APN 7 127,684,846 (GRCm39) critical splice donor site probably null
IGL02348:Itgam APN 7 127,715,472 (GRCm39) missense possibly damaging 0.52
IGL02394:Itgam APN 7 127,684,114 (GRCm39) missense probably benign 0.01
IGL02491:Itgam APN 7 127,715,190 (GRCm39) missense possibly damaging 0.71
IGL02695:Itgam APN 7 127,685,113 (GRCm39) missense possibly damaging 0.81
IGL02821:Itgam APN 7 127,675,281 (GRCm39) missense probably damaging 0.99
IGL02970:Itgam APN 7 127,685,215 (GRCm39) missense probably benign 0.00
IGL03145:Itgam APN 7 127,712,191 (GRCm39) missense probably benign 0.12
adhesion UTSW 7 127,700,709 (GRCm39) missense probably damaging 0.99
apparition UTSW 7 127,711,458 (GRCm39) splice site probably null
attachment UTSW 7 127,712,205 (GRCm39) missense probably damaging 1.00
Follower UTSW 7 127,679,436 (GRCm39) missense probably damaging 1.00
invisible UTSW 7 127,669,875 (GRCm39) splice site probably null
obscured UTSW 7 127,680,806 (GRCm39) missense probably damaging 1.00
R0389:Itgam UTSW 7 127,680,806 (GRCm39) missense probably damaging 1.00
R0443:Itgam UTSW 7 127,680,806 (GRCm39) missense probably damaging 1.00
R0454:Itgam UTSW 7 127,707,152 (GRCm39) missense probably benign 0.01
R0674:Itgam UTSW 7 127,715,390 (GRCm39) missense possibly damaging 0.67
R0828:Itgam UTSW 7 127,715,677 (GRCm39) critical splice donor site probably null
R0925:Itgam UTSW 7 127,711,410 (GRCm39) missense probably benign 0.00
R1086:Itgam UTSW 7 127,679,436 (GRCm39) missense probably damaging 1.00
R1655:Itgam UTSW 7 127,714,335 (GRCm39) missense probably benign 0.00
R1809:Itgam UTSW 7 127,670,109 (GRCm39) missense possibly damaging 0.62
R1823:Itgam UTSW 7 127,663,904 (GRCm39) missense probably benign 0.04
R2105:Itgam UTSW 7 127,680,884 (GRCm39) missense probably damaging 1.00
R2154:Itgam UTSW 7 127,684,749 (GRCm39) missense probably damaging 0.99
R2656:Itgam UTSW 7 127,715,987 (GRCm39) missense probably null 1.00
R2913:Itgam UTSW 7 127,711,578 (GRCm39) missense probably damaging 1.00
R3116:Itgam UTSW 7 127,715,201 (GRCm39) missense probably damaging 1.00
R3404:Itgam UTSW 7 127,669,875 (GRCm39) splice site probably null
R3821:Itgam UTSW 7 127,711,458 (GRCm39) splice site probably null
R3822:Itgam UTSW 7 127,711,458 (GRCm39) splice site probably null
R3960:Itgam UTSW 7 127,714,347 (GRCm39) missense probably benign 0.02
R3968:Itgam UTSW 7 127,712,205 (GRCm39) missense probably damaging 1.00
R4192:Itgam UTSW 7 127,663,904 (GRCm39) missense probably benign 0.21
R4400:Itgam UTSW 7 127,680,830 (GRCm39) missense probably damaging 1.00
R4708:Itgam UTSW 7 127,700,709 (GRCm39) missense probably damaging 0.99
R4709:Itgam UTSW 7 127,700,709 (GRCm39) missense probably damaging 0.99
R4742:Itgam UTSW 7 127,712,245 (GRCm39) missense probably damaging 1.00
R4790:Itgam UTSW 7 127,715,445 (GRCm39) missense probably benign 0.01
R4960:Itgam UTSW 7 127,715,012 (GRCm39) missense possibly damaging 0.93
R5109:Itgam UTSW 7 127,712,390 (GRCm39) missense probably benign 0.06
R5190:Itgam UTSW 7 127,715,489 (GRCm39) splice site probably null
R5379:Itgam UTSW 7 127,711,560 (GRCm39) missense probably damaging 1.00
R5386:Itgam UTSW 7 127,707,152 (GRCm39) missense probably benign 0.00
R6104:Itgam UTSW 7 127,715,474 (GRCm39) missense possibly damaging 0.85
R6122:Itgam UTSW 7 127,684,824 (GRCm39) missense probably damaging 0.99
R6189:Itgam UTSW 7 127,711,676 (GRCm39) missense probably benign 0.04
R6282:Itgam UTSW 7 127,684,114 (GRCm39) missense probably benign 0.01
R6545:Itgam UTSW 7 127,707,044 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCTACTGTGGAAAGGAGGAC -3'
(R):5'- TCACTGCTGGAAATGCTGAGGC -3'

Sequencing Primer
(F):5'- CTTGAGGAACCGTGTCCAAA -3'
(R):5'- ccaaaccccagaaccacag -3'
Posted On 2013-04-16