Incidental Mutation 'R2225:Itih1'
ID239695
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
MMRRC Submission 040226-MU
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2225 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30929577 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 886 (V886A)
Ref Sequence ENSEMBL: ENSMUSP00000126449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006704
AA Change: V890A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: V890A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163118
AA Change: V886A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: V886A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Akap9 A T 5: 4,077,271 R3706S probably damaging Het
Btd A G 14: 31,667,060 D246G probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep152 T C 2: 125,581,784 E899G probably damaging Het
Cpsf6 A T 10: 117,363,036 probably benign Het
Crybg3 A G 16: 59,554,678 I2071T probably damaging Het
Cwc22 T A 2: 77,908,151 probably benign Het
Ddah2 T A 17: 35,060,211 I16N probably damaging Het
Dld T G 12: 31,341,449 M123L probably benign Het
Eif5b A T 1: 38,019,223 K202I unknown Het
Gm6430 T C 1: 97,025,716 noncoding transcript Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Hspa4 C T 11: 53,286,933 V117M probably benign Het
Htra4 T C 8: 25,025,720 D434G probably benign Het
Itgb3 A G 11: 104,665,510 M726V probably benign Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Limk1 G T 5: 134,661,556 probably null Het
Lonrf1 T C 8: 36,236,098 D308G probably damaging Het
Muc4 A T 16: 32,755,891 probably benign Het
Muc4 G A 16: 32,766,942 C2719Y possibly damaging Het
Mvb12b G A 2: 33,840,199 T60I possibly damaging Het
Myh2 C T 11: 67,193,729 T1698M probably benign Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr952 T C 9: 39,426,619 I151V probably benign Het
Olfr975 T C 9: 39,950,537 K78R possibly damaging Het
Plekhg2 G A 7: 28,360,335 P1190S probably benign Het
Reck A G 4: 43,922,837 T371A probably benign Het
Rnf185 T C 11: 3,432,445 D44G probably damaging Het
Rpgrip1l T C 8: 91,221,467 E1196G probably benign Het
Rundc1 A G 11: 101,431,344 probably benign Het
Sf3b3 T C 8: 110,814,573 Y970C probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Shprh T C 10: 11,162,235 probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tbxa2r A G 10: 81,333,149 Y224C probably benign Het
Tlr5 A G 1: 182,972,376 probably benign Het
Tmem270 A G 5: 134,906,638 L21P probably damaging Het
Tmtc2 T C 10: 105,370,357 E359G probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 A G 7: 46,665,174 probably null Het
Wiz C T 17: 32,356,925 V836M probably damaging Het
Zfp451 T A 1: 33,770,907 probably benign Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0744:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1898:Itih1 UTSW 14 30932287 missense probably benign
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R3836:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4388:Itih1 UTSW 14 30941555 missense possibly damaging 0.93
R4504:Itih1 UTSW 14 30935885 missense probably damaging 1.00
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6077:Itih1 UTSW 14 30929876 missense possibly damaging 0.75
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7168:Itih1 UTSW 14 30934107 missense probably null 0.98
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
R7717:Itih1 UTSW 14 30931185 missense probably damaging 1.00
R8016:Itih1 UTSW 14 30935294 missense probably damaging 0.96
R8035:Itih1 UTSW 14 30942525 missense probably benign 0.25
Z1177:Itih1 UTSW 14 30929572 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAGATCACAGGATGTCTTGACAC -3'
(R):5'- TGGGTTAGTGAGTGACCAACG -3'

Sequencing Primer
(F):5'- TTGACACAGGGACCAGTATGCTC -3'
(R):5'- AGTGAGTGACCAACGTTTCTG -3'
Posted On2014-10-15