Incidental Mutation 'R2225:Or2l5'
ID 239698
Institutional Source Beutler Lab
Gene Symbol Or2l5
Ensembl Gene ENSMUSG00000045341
Gene Name olfactory receptor family 2 subfamily L member 5
Synonyms MOR272-1, GA_x54KRFPKG5P-15963726-15962788, Olfr167
MMRRC Submission 040226-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.288) question?
Stock # R2225 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 19333446-19334384 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19333996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 130 (H130R)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
AlphaFold Q8VGJ5
Predicted Effect probably benign
Transcript: ENSMUST00000054606
AA Change: H130R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: H130R

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214315
AA Change: H130R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217566
Meta Mutation Damage Score 0.1493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,813,349 (GRCm39) L439R probably damaging Het
Adcy10 A G 1: 165,345,829 (GRCm39) T293A probably damaging Het
Aen C A 7: 78,552,199 (GRCm39) T15K probably benign Het
Aggf1 A G 13: 95,507,354 (GRCm39) S144P probably damaging Het
Akap9 A T 5: 4,127,271 (GRCm39) R3706S probably damaging Het
Btd A G 14: 31,389,017 (GRCm39) D246G probably benign Het
Ccdc33 A G 9: 57,989,305 (GRCm39) S123P probably damaging Het
Cep152 T C 2: 125,423,704 (GRCm39) E899G probably damaging Het
Cpsf6 A T 10: 117,198,941 (GRCm39) probably benign Het
Crybg3 A G 16: 59,375,041 (GRCm39) I2071T probably damaging Het
Cwc22 T A 2: 77,738,495 (GRCm39) probably benign Het
Ddah2 T A 17: 35,279,187 (GRCm39) I16N probably damaging Het
Dld T G 12: 31,391,448 (GRCm39) M123L probably benign Het
Eif5b A T 1: 38,058,304 (GRCm39) K202I unknown Het
Gm6430 T C 1: 96,953,441 (GRCm39) noncoding transcript Het
Hdac9 C T 12: 34,457,801 (GRCm39) V251I probably benign Het
Hoxa10 T C 6: 52,209,616 (GRCm39) E52G probably damaging Het
Hspa4 C T 11: 53,177,760 (GRCm39) V117M probably benign Het
Htra4 T C 8: 25,515,736 (GRCm39) D434G probably benign Het
Itgb3 A G 11: 104,556,336 (GRCm39) M726V probably benign Het
Itih1 A G 14: 30,651,534 (GRCm39) V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,217,564 (GRCm39) probably null Het
Kpna1 G A 16: 35,851,591 (GRCm39) A392T probably damaging Het
Limk1 G T 5: 134,690,410 (GRCm39) probably null Het
Lonrf1 T C 8: 36,703,252 (GRCm39) D308G probably damaging Het
Muc4 A T 16: 32,576,265 (GRCm39) probably benign Het
Muc4 G A 16: 32,587,316 (GRCm39) C2719Y possibly damaging Het
Mvb12b G A 2: 33,730,211 (GRCm39) T60I possibly damaging Het
Myh2 C T 11: 67,084,555 (GRCm39) T1698M probably benign Het
Naalad2 A T 9: 18,287,829 (GRCm39) V267E possibly damaging Het
Nkpd1 A T 7: 19,253,745 (GRCm39) Y37F probably benign Het
Or10d5 T C 9: 39,861,833 (GRCm39) K78R possibly damaging Het
Or8g33 T C 9: 39,337,915 (GRCm39) I151V probably benign Het
Plekhg2 G A 7: 28,059,760 (GRCm39) P1190S probably benign Het
Reck A G 4: 43,922,837 (GRCm39) T371A probably benign Het
Rnf185 T C 11: 3,382,445 (GRCm39) D44G probably damaging Het
Rpgrip1l T C 8: 91,948,095 (GRCm39) E1196G probably benign Het
Rundc1 A G 11: 101,322,170 (GRCm39) probably benign Het
Sf3b3 T C 8: 111,541,205 (GRCm39) Y970C probably damaging Het
Sfxn1 A G 13: 54,239,536 (GRCm39) T20A possibly damaging Het
Shprh T C 10: 11,037,979 (GRCm39) probably benign Het
Spata31d1a T A 13: 59,851,529 (GRCm39) I200L probably benign Het
Srsf6 G A 2: 162,773,619 (GRCm39) S10N probably damaging Het
Tbxa2r A G 10: 81,168,983 (GRCm39) Y224C probably benign Het
Tlr5 A G 1: 182,799,941 (GRCm39) probably benign Het
Tmem270 A G 5: 134,935,492 (GRCm39) L21P probably damaging Het
Tmtc2 T C 10: 105,206,218 (GRCm39) E359G probably benign Het
Tnn A T 1: 159,975,035 (GRCm39) C131S probably damaging Het
Tnnt2 A G 1: 135,771,529 (GRCm39) probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tph1 A G 7: 46,314,598 (GRCm39) probably null Het
Wiz C T 17: 32,575,899 (GRCm39) V836M probably damaging Het
Zfp451 T A 1: 33,809,988 (GRCm39) probably benign Het
Zfp738 A G 13: 67,818,431 (GRCm39) F520S probably damaging Het
Other mutations in Or2l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Or2l5 APN 16 19,334,228 (GRCm39) missense probably benign 0.01
IGL02115:Or2l5 APN 16 19,333,853 (GRCm39) missense probably damaging 1.00
IGL02562:Or2l5 APN 16 19,333,714 (GRCm39) missense possibly damaging 0.74
BB008:Or2l5 UTSW 16 19,334,258 (GRCm39) missense possibly damaging 0.94
BB018:Or2l5 UTSW 16 19,334,258 (GRCm39) missense possibly damaging 0.94
R0366:Or2l5 UTSW 16 19,333,598 (GRCm39) missense probably benign 0.13
R0673:Or2l5 UTSW 16 19,334,146 (GRCm39) missense probably damaging 1.00
R1187:Or2l5 UTSW 16 19,333,796 (GRCm39) missense probably benign 0.01
R1237:Or2l5 UTSW 16 19,334,375 (GRCm39) missense probably benign 0.01
R1975:Or2l5 UTSW 16 19,333,586 (GRCm39) missense probably damaging 0.99
R1977:Or2l5 UTSW 16 19,333,586 (GRCm39) missense probably damaging 0.99
R1997:Or2l5 UTSW 16 19,333,792 (GRCm39) missense probably damaging 1.00
R2226:Or2l5 UTSW 16 19,333,996 (GRCm39) missense probably benign 0.05
R4078:Or2l5 UTSW 16 19,333,982 (GRCm39) missense possibly damaging 0.76
R5019:Or2l5 UTSW 16 19,334,285 (GRCm39) missense probably damaging 0.99
R5071:Or2l5 UTSW 16 19,333,777 (GRCm39) missense probably benign 0.00
R5278:Or2l5 UTSW 16 19,334,128 (GRCm39) nonsense probably null
R5415:Or2l5 UTSW 16 19,333,996 (GRCm39) missense possibly damaging 0.94
R5744:Or2l5 UTSW 16 19,334,086 (GRCm39) missense probably benign 0.00
R5991:Or2l5 UTSW 16 19,333,507 (GRCm39) missense probably damaging 0.99
R6151:Or2l5 UTSW 16 19,334,281 (GRCm39) missense probably damaging 1.00
R6540:Or2l5 UTSW 16 19,333,571 (GRCm39) missense probably benign
R7014:Or2l5 UTSW 16 19,334,206 (GRCm39) missense probably benign 0.20
R7145:Or2l5 UTSW 16 19,333,649 (GRCm39) missense probably damaging 0.99
R7535:Or2l5 UTSW 16 19,333,544 (GRCm39) missense probably damaging 1.00
R7677:Or2l5 UTSW 16 19,333,678 (GRCm39) missense probably benign 0.42
R7715:Or2l5 UTSW 16 19,333,480 (GRCm39) missense probably benign 0.00
R7931:Or2l5 UTSW 16 19,334,258 (GRCm39) missense possibly damaging 0.94
R8137:Or2l5 UTSW 16 19,333,846 (GRCm39) missense possibly damaging 0.89
R8671:Or2l5 UTSW 16 19,333,804 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAAGCCAGAGTCAACATGGC -3'
(R):5'- TGGTAACCTGTCCATGATCCTC -3'

Sequencing Primer
(F):5'- TCAACATGGCAGGGACATC -3'
(R):5'- CCTGGATTCACATCTCCACAC -3'
Posted On 2014-10-15