Mutagenetix > Incidental Mutations

Incidental Mutation 'R2225:Olfr167'

239698

Institutional Source

Beutler Lab

Gene Symbol

Olfr167

Ensembl Gene

ENSMUSG00000045341

Gene Name

olfactory receptor 167

Synonyms

MOR272-1, GA_x54KRFPKG5P-15963726-15962788

MMRRC Submission

040226-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.335) question?

Stock #

R2225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19509558-19522266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19515246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 130 (H130R)

Ref Sequence

ENSEMBL: ENSMUSP00000150102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]

AlphaFold

Q8VGJ5

Predicted Effect

probably benign
Transcript: ENSMUST00000054606
AA Change: H130R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: H130R

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	306	4.8e-46	PFAM
Pfam:7TM_GPCR_Srsx	33	295	1.2e-6	PFAM
Pfam:7tm_1	40	289	1.8e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214315
AA Change: H130R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217566

Meta Mutation Damage Score

0.1493

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb1	A	C	6: 88,836,367	L439R	probably damaging	Het
Adcy10	A	G	1: 165,518,260	T293A	probably damaging	Het
Aen	C	A	7: 78,902,451	T15K	probably benign	Het
Aggf1	A	G	13: 95,370,846	S144P	probably damaging	Het
Akap9	A	T	5: 4,077,271	R3706S	probably damaging	Het
Btd	A	G	14: 31,667,060	D246G	probably benign	Het
Ccdc33	A	G	9: 58,082,022	S123P	probably damaging	Het
Cep152	T	C	2: 125,581,784	E899G	probably damaging	Het
Cpsf6	A	T	10: 117,363,036		probably benign	Het
Crybg3	A	G	16: 59,554,678	I2071T	probably damaging	Het
Cwc22	T	A	2: 77,908,151		probably benign	Het
Ddah2	T	A	17: 35,060,211	I16N	probably damaging	Het
Dld	T	G	12: 31,341,449	M123L	probably benign	Het
Eif5b	A	T	1: 38,019,223	K202I	unknown	Het
Gm6430	T	C	1: 97,025,716		noncoding transcript	Het
Hdac9	C	T	12: 34,407,802	V251I	probably benign	Het
Hoxa10	T	C	6: 52,232,636	E52G	probably damaging	Het
Hspa4	C	T	11: 53,286,933	V117M	probably benign	Het
Htra4	T	C	8: 25,025,720	D434G	probably benign	Het
Itgb3	A	G	11: 104,665,510	M726V	probably benign	Het
Itih1	A	G	14: 30,929,577	V886A	possibly damaging	Het
Kdm1b	TCATTGTCC	TCATTGTCCATTGTCC	13: 47,064,088		probably null	Het
Kpna1	G	A	16: 36,031,221	A392T	probably damaging	Het
Limk1	G	T	5: 134,661,556		probably null	Het
Lonrf1	T	C	8: 36,236,098	D308G	probably damaging	Het
Muc4	G	A	16: 32,766,942	C2719Y	possibly damaging	Het
Muc4	A	T	16: 32,755,891		probably benign	Het
Mvb12b	G	A	2: 33,840,199	T60I	possibly damaging	Het
Myh2	C	T	11: 67,193,729	T1698M	probably benign	Het
Naalad2	A	T	9: 18,376,533	V267E	possibly damaging	Het
Nkpd1	A	T	7: 19,519,820	Y37F	probably benign	Het
Olfr952	T	C	9: 39,426,619	I151V	probably benign	Het
Olfr975	T	C	9: 39,950,537	K78R	possibly damaging	Het
Plekhg2	G	A	7: 28,360,335	P1190S	probably benign	Het
Reck	A	G	4: 43,922,837	T371A	probably benign	Het
Rnf185	T	C	11: 3,432,445	D44G	probably damaging	Het
Rpgrip1l	T	C	8: 91,221,467	E1196G	probably benign	Het
Rundc1	A	G	11: 101,431,344		probably benign	Het
Sf3b3	T	C	8: 110,814,573	Y970C	probably damaging	Het
Sfxn1	A	G	13: 54,085,517	T20A	possibly damaging	Het
Shprh	T	C	10: 11,162,235		probably benign	Het
Spata31d1a	T	A	13: 59,703,715	I200L	probably benign	Het
Srsf6	G	A	2: 162,931,699	S10N	probably damaging	Het
Tbxa2r	A	G	10: 81,333,149	Y224C	probably benign	Het
Tlr5	A	G	1: 182,972,376		probably benign	Het
Tmem270	A	G	5: 134,906,638	L21P	probably damaging	Het
Tmtc2	T	C	10: 105,370,357	E359G	probably benign	Het
Tnn	A	T	1: 160,147,465	C131S	probably damaging	Het
Tnnt2	A	G	1: 135,843,791		probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tph1	A	G	7: 46,665,174		probably null	Het
Wiz	C	T	17: 32,356,925	V836M	probably damaging	Het
Zfp451	T	A	1: 33,770,907		probably benign	Het
Zfp738	A	G	13: 67,670,312	F520S	probably damaging	Het

Other mutations in Olfr167

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01535:Olfr167	APN	16	19515478	missense	probably benign	0.01
IGL02115:Olfr167	APN	16	19515103	missense	probably damaging	1.00
IGL02562:Olfr167	APN	16	19514964	missense	possibly damaging	0.74
BB008:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
BB018:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
R0366:Olfr167	UTSW	16	19514848	missense	probably benign	0.13
R0673:Olfr167	UTSW	16	19515396	missense	probably damaging	1.00
R1187:Olfr167	UTSW	16	19515046	missense	probably benign	0.01
R1237:Olfr167	UTSW	16	19515625	missense	probably benign	0.01
R1975:Olfr167	UTSW	16	19514836	missense	probably damaging	0.99
R1977:Olfr167	UTSW	16	19514836	missense	probably damaging	0.99
R1997:Olfr167	UTSW	16	19515042	missense	probably damaging	1.00
R2226:Olfr167	UTSW	16	19515246	missense	probably benign	0.05
R4078:Olfr167	UTSW	16	19515232	missense	possibly damaging	0.76
R5019:Olfr167	UTSW	16	19515535	missense	probably damaging	0.99
R5071:Olfr167	UTSW	16	19515027	missense	probably benign	0.00
R5278:Olfr167	UTSW	16	19515378	nonsense	probably null
R5415:Olfr167	UTSW	16	19515246	missense	possibly damaging	0.94
R5744:Olfr167	UTSW	16	19515336	missense	probably benign	0.00
R5991:Olfr167	UTSW	16	19514757	missense	probably damaging	0.99
R6151:Olfr167	UTSW	16	19515531	missense	probably damaging	1.00
R6540:Olfr167	UTSW	16	19514821	missense	probably benign
R7014:Olfr167	UTSW	16	19515456	missense	probably benign	0.20
R7145:Olfr167	UTSW	16	19514899	missense	probably damaging	0.99
R7535:Olfr167	UTSW	16	19514794	missense	probably damaging	1.00
R7677:Olfr167	UTSW	16	19514928	missense	probably benign	0.42
R7715:Olfr167	UTSW	16	19514730	missense	probably benign	0.00
R7931:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
R8137:Olfr167	UTSW	16	19515096	missense	possibly damaging	0.89
R8671:Olfr167	UTSW	16	19515054	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- CAAGCCAGAGTCAACATGGC -3'
(R):5'- TGGTAACCTGTCCATGATCCTC -3'

Sequencing Primer
(F):5'- TCAACATGGCAGGGACATC -3'
(R):5'- CCTGGATTCACATCTCCACAC -3'

Posted On

2014-10-15