Incidental Mutation 'R0184:Pkp3'
ID 23970
Institutional Source Beutler Lab
Gene Symbol Pkp3
Ensembl Gene ENSMUSG00000054065
Gene Name plakophilin 3
Synonyms 2310056L12Rik
MMRRC Submission 038449-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R0184 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 140658202-140670424 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 140668280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 536 (N536T)
Ref Sequence ENSEMBL: ENSMUSP00000101654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066873] [ENSMUST00000097958] [ENSMUST00000106039] [ENSMUST00000209199] [ENSMUST00000210167] [ENSMUST00000209294]
AlphaFold Q9QY23
Predicted Effect probably benign
Transcript: ENSMUST00000066873
AA Change: N511T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000069961
Gene: ENSMUSG00000054065
AA Change: N511T

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
ARM 350 390 8.11e-5 SMART
ARM 392 432 3.24e-4 SMART
ARM 489 536 3.85e0 SMART
internal_repeat_1 605 702 2.91e-9 PROSPERO
low complexity region 717 731 N/A INTRINSIC
low complexity region 757 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097958
SMART Domains Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

DomainStartEndE-ValueType
IG 17 112 5.21e-2 SMART
transmembrane domain 117 139 N/A INTRINSIC
Pfam:TIR 163 327 2.2e-19 PFAM
Pfam:TIR_2 166 308 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106039
AA Change: N536T

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101654
Gene: ENSMUSG00000054065
AA Change: N536T

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 204 219 N/A INTRINSIC
low complexity region 244 253 N/A INTRINSIC
ARM 375 415 8.11e-5 SMART
ARM 417 457 3.24e-4 SMART
ARM 514 561 3.85e0 SMART
internal_repeat_1 630 727 4.99e-9 PROSPERO
low complexity region 742 756 N/A INTRINSIC
low complexity region 782 799 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161142
Predicted Effect probably benign
Transcript: ENSMUST00000209199
Predicted Effect probably benign
Transcript: ENSMUST00000210167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210941
Predicted Effect probably benign
Transcript: ENSMUST00000209887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210978
Predicted Effect probably benign
Transcript: ENSMUST00000209294
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may act in cellular desmosome-dependent adhesion and signaling pathways. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded hair growth, epidermal thickening and abnormal hair follicles that lead to secondary alopecia and acute dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,212,899 (GRCm39) V131F probably damaging Het
Adam28 T C 14: 68,874,822 (GRCm39) D285G probably benign Het
Akr1c13 A G 13: 4,244,055 (GRCm39) E36G probably damaging Het
Antxr2 A G 5: 98,127,889 (GRCm39) L214S probably damaging Het
Arhgap26 T A 18: 38,750,726 (GRCm39) D46E unknown Het
Armc9 T C 1: 86,126,092 (GRCm39) L61P probably damaging Het
Bicc1 C A 10: 70,915,045 (GRCm39) R73L probably benign Het
Calm2 T C 17: 87,743,269 (GRCm39) N43S probably benign Het
Cct7 A G 6: 85,438,536 (GRCm39) D105G probably null Het
Cdk18 T C 1: 132,046,276 (GRCm39) N215D probably benign Het
Cep126 T C 9: 8,103,396 (GRCm39) T205A probably benign Het
Cfap57 A T 4: 118,456,209 (GRCm39) I495N probably damaging Het
Cyp2b9 T A 7: 25,886,432 (GRCm39) C152* probably null Het
Dab2ip G A 2: 35,608,803 (GRCm39) R579H probably damaging Het
Dnah8 T C 17: 30,902,657 (GRCm39) V905A probably benign Het
Eif4h C A 5: 134,654,229 (GRCm39) D134Y possibly damaging Het
Espl1 T A 15: 102,207,651 (GRCm39) S372T probably benign Het
Fat2 T A 11: 55,187,114 (GRCm39) H1244L probably damaging Het
Fbxo11 T A 17: 88,316,101 (GRCm39) N443I probably benign Het
Git2 G A 5: 114,877,098 (GRCm39) T128M possibly damaging Het
Gm10985 T A 3: 53,752,679 (GRCm39) Y21N probably damaging Het
Gm12790 A T 4: 101,824,811 (GRCm39) Y152* probably null Het
Heatr5a T C 12: 51,956,752 (GRCm39) D1115G probably benign Het
Hipk2 T C 6: 38,695,866 (GRCm39) N726S possibly damaging Het
Hrg T C 16: 22,772,521 (GRCm39) probably null Het
Iars1 T G 13: 49,875,688 (GRCm39) S792A probably benign Het
Igf1r A G 7: 67,875,941 (GRCm39) N1301S possibly damaging Het
Il22 A T 10: 118,041,511 (GRCm39) I75F probably damaging Het
Ilkap T C 1: 91,304,027 (GRCm39) probably benign Het
Ints13 A T 6: 146,456,542 (GRCm39) Y435N probably benign Het
Ints8 A C 4: 11,218,637 (GRCm39) S797A probably benign Het
Itgad T A 7: 127,788,403 (GRCm39) D405E probably benign Het
Itgam A T 7: 127,685,230 (GRCm39) I448F probably damaging Het
Klk1 C T 7: 43,878,173 (GRCm39) T41I possibly damaging Het
Mcrip1 T C 11: 120,435,710 (GRCm39) M1V probably null Het
Mdga1 A G 17: 30,071,416 (GRCm39) Y128H probably damaging Het
Mtor G T 4: 148,549,428 (GRCm39) R604L probably benign Het
Or52p1 T C 7: 104,267,447 (GRCm39) V187A probably damaging Het
Or5d41 A T 2: 88,055,124 (GRCm39) L84* probably null Het
Pcdhb7 T A 18: 37,476,443 (GRCm39) D526E probably benign Het
Pip4k2a T C 2: 18,893,939 (GRCm39) D139G probably damaging Het
Pla2g4c T A 7: 13,090,145 (GRCm39) S524T probably benign Het
Pno1 T C 11: 17,161,127 (GRCm39) E69G probably benign Het
Pold1 C T 7: 44,191,139 (GRCm39) V231M probably benign Het
Poli A G 18: 70,655,802 (GRCm39) S248P probably damaging Het
Ppox C T 1: 171,107,126 (GRCm39) S138N probably damaging Het
Psg20 T C 7: 18,419,901 (GRCm39) E6G probably null Het
Rbmx C T X: 56,436,926 (GRCm39) probably null Het
Rln1 T A 19: 29,309,336 (GRCm39) K148* probably null Het
Rnf213 C T 11: 119,305,347 (GRCm39) T526I probably damaging Het
Rps6kc1 A T 1: 190,531,290 (GRCm39) V904E probably null Het
Sf3b2 T A 19: 5,333,700 (GRCm39) I633F probably damaging Het
Sfswap T A 5: 129,584,253 (GRCm39) I189N probably damaging Het
Smarca2 T A 19: 26,669,649 (GRCm39) Y973* probably null Het
Spink5 G A 18: 44,136,265 (GRCm39) D559N probably benign Het
Spty2d1 C T 7: 46,647,322 (GRCm39) V536I possibly damaging Het
Tbx3 T C 5: 119,813,627 (GRCm39) I221T probably damaging Het
Tcf20 T A 15: 82,736,501 (GRCm39) D1650V probably damaging Het
Thsd7b A G 1: 129,358,701 (GRCm39) K45R probably benign Het
Tirap A G 9: 35,100,490 (GRCm39) S65P probably benign Het
Trim25 C T 11: 88,890,466 (GRCm39) P51L probably damaging Het
Trim61 T C 8: 65,467,069 (GRCm39) N64S probably benign Het
Twf1 T A 15: 94,478,948 (GRCm39) probably null Het
Ubr4 A C 4: 139,172,573 (GRCm39) T1692P probably damaging Het
Usp3 A G 9: 66,469,863 (GRCm39) M86T probably damaging Het
Utrn T C 10: 12,543,362 (GRCm39) D1762G probably benign Het
V1rd19 T A 7: 23,702,632 (GRCm39) F33I probably benign Het
Vmn2r52 T C 7: 9,893,265 (GRCm39) S625G probably damaging Het
Vmn2r90 G A 17: 17,947,139 (GRCm39) W472* probably null Het
Vrk2 C A 11: 26,500,046 (GRCm39) A56S probably damaging Het
Yeats2 C T 16: 20,022,435 (GRCm39) P620S possibly damaging Het
Zbtb21 C T 16: 97,751,713 (GRCm39) D171N probably damaging Het
Zeb1 A T 18: 5,766,808 (GRCm39) I440F probably damaging Het
Zfp292 A G 4: 34,819,563 (GRCm39) I253T probably damaging Het
Other mutations in Pkp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pkp3 APN 7 140,664,095 (GRCm39) nonsense probably null
IGL01367:Pkp3 APN 7 140,663,989 (GRCm39) missense probably damaging 1.00
IGL01793:Pkp3 APN 7 140,668,817 (GRCm39) missense probably benign 0.01
IGL02140:Pkp3 APN 7 140,669,249 (GRCm39) missense probably damaging 1.00
IGL02231:Pkp3 APN 7 140,664,151 (GRCm39) missense probably damaging 1.00
IGL02708:Pkp3 APN 7 140,669,681 (GRCm39) unclassified probably benign
IGL02755:Pkp3 APN 7 140,668,318 (GRCm39) splice site probably null
IGL03017:Pkp3 APN 7 140,663,283 (GRCm39) missense probably benign 0.12
IGL03351:Pkp3 APN 7 140,662,606 (GRCm39) missense probably benign
PIT4514001:Pkp3 UTSW 7 140,669,623 (GRCm39) missense probably damaging 0.99
R0145:Pkp3 UTSW 7 140,669,676 (GRCm39) critical splice donor site probably null
R0153:Pkp3 UTSW 7 140,663,256 (GRCm39) missense probably damaging 1.00
R1014:Pkp3 UTSW 7 140,662,739 (GRCm39) missense probably benign 0.03
R1664:Pkp3 UTSW 7 140,667,560 (GRCm39) missense probably damaging 1.00
R1844:Pkp3 UTSW 7 140,668,415 (GRCm39) missense probably damaging 1.00
R1891:Pkp3 UTSW 7 140,663,969 (GRCm39) splice site probably null
R2100:Pkp3 UTSW 7 140,663,205 (GRCm39) missense probably damaging 1.00
R3772:Pkp3 UTSW 7 140,662,259 (GRCm39) start codon destroyed probably null
R4003:Pkp3 UTSW 7 140,668,650 (GRCm39) critical splice acceptor site probably null
R4089:Pkp3 UTSW 7 140,664,056 (GRCm39) missense probably damaging 1.00
R4670:Pkp3 UTSW 7 140,662,612 (GRCm39) missense probably benign 0.00
R5266:Pkp3 UTSW 7 140,663,190 (GRCm39) missense probably damaging 1.00
R5619:Pkp3 UTSW 7 140,668,419 (GRCm39) missense probably damaging 1.00
R6113:Pkp3 UTSW 7 140,662,569 (GRCm39) missense probably damaging 0.97
R6820:Pkp3 UTSW 7 140,659,757 (GRCm39) critical splice donor site probably null
R7650:Pkp3 UTSW 7 140,662,283 (GRCm39) missense probably benign 0.00
R7662:Pkp3 UTSW 7 140,658,292 (GRCm39) missense probably benign 0.03
R8087:Pkp3 UTSW 7 140,667,551 (GRCm39) missense possibly damaging 0.56
R8335:Pkp3 UTSW 7 140,667,669 (GRCm39) missense probably damaging 1.00
R9525:Pkp3 UTSW 7 140,668,310 (GRCm39) missense probably damaging 1.00
X0028:Pkp3 UTSW 7 140,669,861 (GRCm39) splice site probably null
Z1177:Pkp3 UTSW 7 140,662,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGGGACATCCATCTTCCTAAAC -3'
(R):5'- TAGGACAGGTTCCTCAGCACACAC -3'

Sequencing Primer
(F):5'- ATGATTTCATCTCCAGGACAGGG -3'
(R):5'- ACACAGCATTTTCCACACTCTG -3'
Posted On 2013-04-16