Incidental Mutation 'R0184:Pkp3'
ID 23970
Institutional Source Beutler Lab
Gene Symbol Pkp3
Ensembl Gene ENSMUSG00000054065
Gene Name plakophilin 3
Synonyms
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R0184 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 141078218-141090510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 141088367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 536 (N536T)
Ref Sequence ENSEMBL: ENSMUSP00000101654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066873] [ENSMUST00000097958] [ENSMUST00000106039] [ENSMUST00000209199] [ENSMUST00000209294] [ENSMUST00000210167]
AlphaFold Q9QY23
Predicted Effect probably benign
Transcript: ENSMUST00000066873
AA Change: N511T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000069961
Gene: ENSMUSG00000054065
AA Change: N511T

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
ARM 350 390 8.11e-5 SMART
ARM 392 432 3.24e-4 SMART
ARM 489 536 3.85e0 SMART
internal_repeat_1 605 702 2.91e-9 PROSPERO
low complexity region 717 731 N/A INTRINSIC
low complexity region 757 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097958
SMART Domains Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

DomainStartEndE-ValueType
IG 17 112 5.21e-2 SMART
transmembrane domain 117 139 N/A INTRINSIC
Pfam:TIR 163 327 2.2e-19 PFAM
Pfam:TIR_2 166 308 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106039
AA Change: N536T

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101654
Gene: ENSMUSG00000054065
AA Change: N536T

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 204 219 N/A INTRINSIC
low complexity region 244 253 N/A INTRINSIC
ARM 375 415 8.11e-5 SMART
ARM 417 457 3.24e-4 SMART
ARM 514 561 3.85e0 SMART
internal_repeat_1 630 727 4.99e-9 PROSPERO
low complexity region 742 756 N/A INTRINSIC
low complexity region 782 799 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161142
Predicted Effect probably benign
Transcript: ENSMUST00000209199
Predicted Effect probably benign
Transcript: ENSMUST00000209294
Predicted Effect probably benign
Transcript: ENSMUST00000209887
Predicted Effect probably benign
Transcript: ENSMUST00000210167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210978
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may act in cellular desmosome-dependent adhesion and signaling pathways. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded hair growth, epidermal thickening and abnormal hair follicles that lead to secondary alopecia and acute dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Pkp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pkp3 APN 7 141084182 nonsense probably null
IGL01367:Pkp3 APN 7 141084076 missense probably damaging 1.00
IGL01793:Pkp3 APN 7 141088904 missense probably benign 0.01
IGL02140:Pkp3 APN 7 141089336 missense probably damaging 1.00
IGL02231:Pkp3 APN 7 141084238 missense probably damaging 1.00
IGL02708:Pkp3 APN 7 141089768 unclassified probably benign
IGL02755:Pkp3 APN 7 141088405 splice site probably null
IGL03017:Pkp3 APN 7 141083370 missense probably benign 0.12
IGL03351:Pkp3 APN 7 141082693 missense probably benign
PIT4514001:Pkp3 UTSW 7 141089710 missense probably damaging 0.99
R0145:Pkp3 UTSW 7 141089763 critical splice donor site probably null
R0153:Pkp3 UTSW 7 141083343 missense probably damaging 1.00
R1014:Pkp3 UTSW 7 141082826 missense probably benign 0.03
R1664:Pkp3 UTSW 7 141087647 missense probably damaging 1.00
R1844:Pkp3 UTSW 7 141088502 missense probably damaging 1.00
R1891:Pkp3 UTSW 7 141084056 splice site probably null
R2100:Pkp3 UTSW 7 141083292 missense probably damaging 1.00
R3772:Pkp3 UTSW 7 141082346 start codon destroyed probably null
R4003:Pkp3 UTSW 7 141088737 critical splice acceptor site probably null
R4089:Pkp3 UTSW 7 141084143 missense probably damaging 1.00
R4670:Pkp3 UTSW 7 141082699 missense probably benign 0.00
R5266:Pkp3 UTSW 7 141083277 missense probably damaging 1.00
R5619:Pkp3 UTSW 7 141088506 missense probably damaging 1.00
R6113:Pkp3 UTSW 7 141082656 missense probably damaging 0.97
R6820:Pkp3 UTSW 7 141079844 critical splice donor site probably null
R7650:Pkp3 UTSW 7 141082370 missense probably benign 0.00
R7662:Pkp3 UTSW 7 141078379 missense probably benign 0.03
R8087:Pkp3 UTSW 7 141087638 missense possibly damaging 0.56
R8335:Pkp3 UTSW 7 141087756 missense probably damaging 1.00
R9525:Pkp3 UTSW 7 141088397 missense probably damaging 1.00
X0028:Pkp3 UTSW 7 141089948 splice site probably null
Z1177:Pkp3 UTSW 7 141082735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGGGACATCCATCTTCCTAAAC -3'
(R):5'- TAGGACAGGTTCCTCAGCACACAC -3'

Sequencing Primer
(F):5'- ATGATTTCATCTCCAGGACAGGG -3'
(R):5'- ACACAGCATTTTCCACACTCTG -3'
Posted On 2013-04-16