Incidental Mutation 'R2225:Wiz'
ID239703
Institutional Source Beutler Lab
Gene Symbol Wiz
Ensembl Gene ENSMUSG00000024050
Gene Namewidely-interspaced zinc finger motifs
Synonyms
MMRRC Submission 040226-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2225 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32354055-32389401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32356925 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 836 (V836M)
Ref Sequence ENSEMBL: ENSMUSP00000126253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064694] [ENSMUST00000087703] [ENSMUST00000163107] [ENSMUST00000165912] [ENSMUST00000169488] [ENSMUST00000170617]
Predicted Effect probably damaging
Transcript: ENSMUST00000064694
AA Change: V827M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069443
Gene: ENSMUSG00000024050
AA Change: V827M

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 532 554 1.67e-2 SMART
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
ZnF_C2H2 702 724 1.41e0 SMART
low complexity region 784 793 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
ZnF_C2H2 901 927 1.06e2 SMART
low complexity region 936 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087703
AA Change: V826M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084993
Gene: ENSMUSG00000024050
AA Change: V826M

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 531 553 1.67e-2 SMART
low complexity region 575 587 N/A INTRINSIC
low complexity region 606 622 N/A INTRINSIC
ZnF_C2H2 701 723 1.41e0 SMART
low complexity region 783 792 N/A INTRINSIC
low complexity region 868 886 N/A INTRINSIC
ZnF_C2H2 900 926 1.06e2 SMART
low complexity region 935 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163107
SMART Domains Protein: ENSMUSP00000127943
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165912
SMART Domains Protein: ENSMUSP00000127651
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168943
Predicted Effect probably damaging
Transcript: ENSMUST00000169488
AA Change: V836M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126253
Gene: ENSMUSG00000024050
AA Change: V836M

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
ZnF_C2H2 54 76 4.72e-2 SMART
ZnF_C2H2 227 249 3.52e-1 SMART
low complexity region 294 318 N/A INTRINSIC
ZnF_C2H2 357 379 1.67e-2 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 448 467 N/A INTRINSIC
ZnF_C2H2 541 563 1.67e-2 SMART
low complexity region 585 597 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ZnF_C2H2 711 733 1.41e0 SMART
low complexity region 793 802 N/A INTRINSIC
low complexity region 878 896 N/A INTRINSIC
ZnF_C2H2 910 936 1.06e2 SMART
low complexity region 945 965 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169741
Predicted Effect probably benign
Transcript: ENSMUST00000170617
SMART Domains Protein: ENSMUSP00000130517
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Meta Mutation Damage Score 0.1694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Akap9 A T 5: 4,077,271 R3706S probably damaging Het
Btd A G 14: 31,667,060 D246G probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep152 T C 2: 125,581,784 E899G probably damaging Het
Cpsf6 A T 10: 117,363,036 probably benign Het
Crybg3 A G 16: 59,554,678 I2071T probably damaging Het
Cwc22 T A 2: 77,908,151 probably benign Het
Ddah2 T A 17: 35,060,211 I16N probably damaging Het
Dld T G 12: 31,341,449 M123L probably benign Het
Eif5b A T 1: 38,019,223 K202I unknown Het
Gm6430 T C 1: 97,025,716 noncoding transcript Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Hspa4 C T 11: 53,286,933 V117M probably benign Het
Htra4 T C 8: 25,025,720 D434G probably benign Het
Itgb3 A G 11: 104,665,510 M726V probably benign Het
Itih1 A G 14: 30,929,577 V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Limk1 G T 5: 134,661,556 probably null Het
Lonrf1 T C 8: 36,236,098 D308G probably damaging Het
Muc4 A T 16: 32,755,891 probably benign Het
Muc4 G A 16: 32,766,942 C2719Y possibly damaging Het
Mvb12b G A 2: 33,840,199 T60I possibly damaging Het
Myh2 C T 11: 67,193,729 T1698M probably benign Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr952 T C 9: 39,426,619 I151V probably benign Het
Olfr975 T C 9: 39,950,537 K78R possibly damaging Het
Plekhg2 G A 7: 28,360,335 P1190S probably benign Het
Reck A G 4: 43,922,837 T371A probably benign Het
Rnf185 T C 11: 3,432,445 D44G probably damaging Het
Rpgrip1l T C 8: 91,221,467 E1196G probably benign Het
Rundc1 A G 11: 101,431,344 probably benign Het
Sf3b3 T C 8: 110,814,573 Y970C probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Shprh T C 10: 11,162,235 probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tbxa2r A G 10: 81,333,149 Y224C probably benign Het
Tlr5 A G 1: 182,972,376 probably benign Het
Tmem270 A G 5: 134,906,638 L21P probably damaging Het
Tmtc2 T C 10: 105,370,357 E359G probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 A G 7: 46,665,174 probably null Het
Zfp451 T A 1: 33,770,907 probably benign Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Wiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Wiz APN 17 32356919 missense probably benign 0.43
IGL02176:Wiz APN 17 32356902 missense probably damaging 0.96
IGL02212:Wiz APN 17 32368135 missense probably damaging 1.00
IGL02213:Wiz APN 17 32367860 missense probably benign 0.03
IGL02616:Wiz APN 17 32359469 missense probably damaging 1.00
IGL02654:Wiz APN 17 32359350 missense probably damaging 1.00
IGL02833:Wiz APN 17 32357879 missense probably damaging 1.00
IGL03032:Wiz APN 17 32356558 missense probably benign
E0370:Wiz UTSW 17 32355118 missense probably damaging 1.00
IGL03138:Wiz UTSW 17 32359119 missense probably damaging 1.00
PIT4494001:Wiz UTSW 17 32361931 missense probably damaging 1.00
R0197:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0207:Wiz UTSW 17 32357033 missense probably damaging 1.00
R0701:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0883:Wiz UTSW 17 32356441 missense probably damaging 1.00
R1055:Wiz UTSW 17 32387642 missense probably damaging 0.99
R1968:Wiz UTSW 17 32359372 missense probably damaging 1.00
R2423:Wiz UTSW 17 32361885 missense probably damaging 1.00
R2860:Wiz UTSW 17 32361706 missense probably damaging 1.00
R2861:Wiz UTSW 17 32361706 missense probably damaging 1.00
R3056:Wiz UTSW 17 32357697 missense probably benign 0.01
R3755:Wiz UTSW 17 32359132 missense probably damaging 1.00
R3885:Wiz UTSW 17 32357038 missense possibly damaging 0.48
R3933:Wiz UTSW 17 32357898 missense probably damaging 1.00
R4038:Wiz UTSW 17 32359224 missense probably damaging 1.00
R4118:Wiz UTSW 17 32369357 utr 3 prime probably benign
R4181:Wiz UTSW 17 32367985 missense probably damaging 1.00
R4651:Wiz UTSW 17 32357681 missense probably damaging 1.00
R4822:Wiz UTSW 17 32356437 nonsense probably null
R4891:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R4923:Wiz UTSW 17 32361596 missense probably benign 0.01
R5014:Wiz UTSW 17 32359366 missense probably damaging 1.00
R5194:Wiz UTSW 17 32377848 utr 3 prime probably benign
R5254:Wiz UTSW 17 32378496 splice site probably benign
R5944:Wiz UTSW 17 32357697 missense probably benign 0.01
R6015:Wiz UTSW 17 32387600 missense probably damaging 0.99
R6263:Wiz UTSW 17 32360443 intron probably null
R6571:Wiz UTSW 17 32359324 missense probably damaging 1.00
R6823:Wiz UTSW 17 32360421 missense probably damaging 0.99
R7014:Wiz UTSW 17 32361866 missense probably damaging 0.98
R7051:Wiz UTSW 17 32361533 missense probably damaging 1.00
R7144:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R7221:Wiz UTSW 17 32359165 missense probably benign 0.03
R7260:Wiz UTSW 17 32359111 missense probably damaging 0.99
R7453:Wiz UTSW 17 32379075 missense probably benign 0.00
R7849:Wiz UTSW 17 32357786 missense probably benign 0.26
R7932:Wiz UTSW 17 32357786 missense probably benign 0.26
U24488:Wiz UTSW 17 32387675 missense probably damaging 1.00
X0026:Wiz UTSW 17 32387758 start codon destroyed probably null 0.94
Z1176:Wiz UTSW 17 32361495 missense not run
Z1177:Wiz UTSW 17 32357778 missense not run
Predicted Primers PCR Primer
(F):5'- GTTGGGACTTAAGGCTAGGC -3'
(R):5'- GCCGCCCCTTTACAAAGAAG -3'

Sequencing Primer
(F):5'- GCTAGGCCTCAAATGCACTGATAG -3'
(R):5'- CCTTTACAAAGAAGTTTCGCAGCG -3'
Posted On2014-10-15