Incidental Mutation 'R0184:Trim61'
List |< first << previous [record 63 of 75] next >> last >|
ID23971
Institutional Source Beutler Lab
Gene Symbol Trim61
Ensembl Gene ENSMUSG00000109718
Gene Nametripartite motif-containing 61
Synonyms2czf61, E330039K03Rik, Rnf35
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R0184 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location65012987-65018523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65014417 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 64 (N64S)
Ref Sequence ENSEMBL: ENSMUSP00000077513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048565] [ENSMUST00000078409]
Predicted Effect probably benign
Transcript: ENSMUST00000048565
SMART Domains Protein: ENSMUSP00000040299
Gene: ENSMUSG00000053490

DomainStartEndE-ValueType
RING 15 55 1.48e-7 SMART
low complexity region 81 90 N/A INTRINSIC
BBOX 91 132 3.12e-6 SMART
PRY 289 341 4.11e-15 SMART
Pfam:SPRY 344 459 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078409
AA Change: N64S

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077513
Gene: ENSMUSG00000109718
AA Change: N64S

DomainStartEndE-ValueType
RING 16 56 4.66e-5 SMART
low complexity region 157 170 N/A INTRINSIC
coiled coil region 201 232 N/A INTRINSIC
PRY 280 331 1.35e-10 SMART
Pfam:SPRY 334 458 5.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148141
Predicted Effect unknown
Transcript: ENSMUST00000211310
AA Change: N31S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211739
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Trim61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Trim61 APN 8 65014091 missense possibly damaging 0.94
R1955:Trim61 UTSW 8 65013392 missense possibly damaging 0.46
R3928:Trim61 UTSW 8 65013317 missense probably benign 0.39
R3929:Trim61 UTSW 8 65013317 missense probably benign 0.39
R4850:Trim61 UTSW 8 65013418 missense probably damaging 1.00
R6249:Trim61 UTSW 8 65014456 missense probably benign 0.25
R6390:Trim61 UTSW 8 65014190 missense probably benign 0.24
R6406:Trim61 UTSW 8 65013725 missense possibly damaging 0.61
R7159:Trim61 UTSW 8 65013874 missense probably benign 0.19
R7182:Trim61 UTSW 8 65013614 missense probably damaging 0.99
X0022:Trim61 UTSW 8 65013313 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCACGGGCCAAACAAAGTGATTC -3'
(R):5'- AAGCAGTGTGTCCTCTCCCACAAC -3'

Sequencing Primer
(F):5'- ATTCGGGGGGAAGCTGC -3'
(R):5'- AACCTTTGTTCAGGGCTCAATG -3'
Posted On2013-04-16