Incidental Mutation 'R2226:Hectd3'
ID 239715
Institutional Source Beutler Lab
Gene Symbol Hectd3
Ensembl Gene ENSMUSG00000046861
Gene Name HECT domain E3 ubiquitin protein ligase 3
Synonyms 1700064K09Rik
MMRRC Submission 040227-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2226 (G1)
Quality Score 138
Status Not validated
Chromosome 4
Chromosomal Location 116995317-117005277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116995689 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 96 (I96T)
Ref Sequence ENSEMBL: ENSMUSP00000051922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030446] [ENSMUST00000050067] [ENSMUST00000130273]
AlphaFold Q3U487
Predicted Effect probably benign
Transcript: ENSMUST00000030446
SMART Domains Protein: ENSMUSP00000030446
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 14 360 2.4e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000050067
AA Change: I96T

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: I96T

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
APC10 237 391 6.75e-23 SMART
HECTc 514 857 1.27e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127635
Predicted Effect probably benign
Transcript: ENSMUST00000130273
SMART Domains Protein: ENSMUSP00000116154
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 1 64 1.2e-18 PFAM
Pfam:URO-D 60 120 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155267
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A T 4: 144,463,725 V2E possibly damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Ascc3 A G 10: 50,754,052 T1746A probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
Atp1b3 A G 9: 96,343,276 F113S probably damaging Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc150 A G 1: 54,364,925 I943V probably null Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Efhb A T 17: 53,462,429 probably null Het
Elfn2 A G 15: 78,674,243 W35R probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Epha2 G A 4: 141,321,237 R569H probably damaging Het
Gabrg2 A T 11: 41,971,908 F116L probably damaging Het
Gm11555 T G 11: 99,649,759 R141S unknown Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm5415 A T 1: 32,545,853 H325Q probably damaging Het
Hnrnpul2 T A 19: 8,824,985 N405K probably damaging Het
Iigp1 A T 18: 60,389,888 K26I possibly damaging Het
Kirrel2 T C 7: 30,454,154 K260R probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt19 T C 11: 100,141,575 E260G probably damaging Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mthfd2l G T 5: 90,948,834 E105* probably null Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Ndufaf5 T C 2: 140,188,860 V222A probably benign Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Nsun7 T A 5: 66,261,219 Y97* probably null Het
Nxph3 T C 11: 95,514,164 Y17C probably benign Het
Olfr1110 A C 2: 87,136,246 V25G possibly damaging Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr586 A G 7: 103,121,908 M292T probably benign Het
Olfr728 A G 14: 50,140,619 S7P probably damaging Het
Olfr832 A T 9: 18,944,881 I78F probably damaging Het
P2rx2 A G 5: 110,342,879 F26S probably damaging Het
Pank1 A T 19: 34,827,363 L131Q probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppwd1 A G 13: 104,217,245 L335P probably damaging Het
Ptch1 A G 13: 63,513,671 S1218P probably damaging Het
Ptpn4 C T 1: 119,682,785 R664Q probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Slc22a19 C T 19: 7,683,850 V320M possibly damaging Het
Slc25a33 A T 4: 149,753,849 I122N probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Ttc12 A G 9: 49,441,835 probably null Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Hectd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Hectd3 APN 4 117000588 splice site probably benign
IGL00227:Hectd3 APN 4 117000587 splice site probably benign
IGL00227:Hectd3 APN 4 117000589 splice site probably benign
IGL00987:Hectd3 APN 4 116999643 missense probably damaging 0.98
IGL01402:Hectd3 APN 4 116996065 missense probably damaging 0.96
IGL01660:Hectd3 APN 4 116996372 missense possibly damaging 0.91
IGL02397:Hectd3 APN 4 117003136 missense possibly damaging 0.94
IGL03029:Hectd3 APN 4 116996965 nonsense probably null
chopstix2 UTSW 4 116996396 missense probably benign 0.08
R0147:Hectd3 UTSW 4 116997040 unclassified probably benign
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0611:Hectd3 UTSW 4 116996044 missense possibly damaging 0.67
R1367:Hectd3 UTSW 4 116997170 missense probably null 0.48
R1401:Hectd3 UTSW 4 117002269 missense possibly damaging 0.52
R1444:Hectd3 UTSW 4 116996396 missense probably benign 0.08
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1517:Hectd3 UTSW 4 117002994 missense probably damaging 0.96
R1584:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1593:Hectd3 UTSW 4 116997020 missense possibly damaging 0.86
R1628:Hectd3 UTSW 4 116997392 missense probably damaging 1.00
R1669:Hectd3 UTSW 4 116999643 missense probably damaging 0.98
R1731:Hectd3 UTSW 4 116996455 critical splice donor site probably null
R1918:Hectd3 UTSW 4 117000343 missense possibly damaging 0.68
R2029:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R2174:Hectd3 UTSW 4 116999701 missense probably benign 0.04
R2184:Hectd3 UTSW 4 117000903 missense possibly damaging 0.93
R3721:Hectd3 UTSW 4 116999745 missense probably benign 0.08
R3895:Hectd3 UTSW 4 116996089 missense probably damaging 1.00
R3937:Hectd3 UTSW 4 116998530 missense probably benign 0.28
R4291:Hectd3 UTSW 4 116995692 missense probably damaging 1.00
R4729:Hectd3 UTSW 4 116997218 missense probably damaging 0.98
R4837:Hectd3 UTSW 4 117002597 missense probably null 0.32
R5059:Hectd3 UTSW 4 116997164 missense possibly damaging 0.93
R5090:Hectd3 UTSW 4 117000238 splice site probably benign
R5910:Hectd3 UTSW 4 117002134 missense probably benign 0.09
R5932:Hectd3 UTSW 4 117002273 missense possibly damaging 0.79
R6182:Hectd3 UTSW 4 117000279 missense probably damaging 1.00
R6292:Hectd3 UTSW 4 116998808 missense probably damaging 1.00
R6405:Hectd3 UTSW 4 117000624 missense probably benign 0.04
R6478:Hectd3 UTSW 4 116999586 missense probably damaging 1.00
R7444:Hectd3 UTSW 4 116996927 missense possibly damaging 0.48
R7471:Hectd3 UTSW 4 116996588 missense probably benign 0.01
R8053:Hectd3 UTSW 4 117000858 missense possibly damaging 0.65
R8671:Hectd3 UTSW 4 116996581 missense possibly damaging 0.67
R8840:Hectd3 UTSW 4 116998407 missense probably benign 0.14
Z1177:Hectd3 UTSW 4 116998760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCACTTCAGCGGCTTC -3'
(R):5'- TGCCAGCTCATTATGGGATAAGG -3'

Sequencing Primer
(F):5'- CTTCGCTATGGCCGGCC -3'
(R):5'- CTCATTATGGGATAAGGGGGCG -3'
Posted On 2014-10-15