Incidental Mutation 'R2226:BC005561'
ID239723
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
MMRRC Submission 040227-MU
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R2226 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104519420 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 603 (Y603N)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably damaging
Transcript: ENSMUST00000096452
AA Change: Y603N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: Y603N

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A T 4: 144,463,725 V2E possibly damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Ascc3 A G 10: 50,754,052 T1746A probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
Atp1b3 A G 9: 96,343,276 F113S probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc150 A G 1: 54,364,925 I943V probably null Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Efhb A T 17: 53,462,429 probably null Het
Elfn2 A G 15: 78,674,243 W35R probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Epha2 G A 4: 141,321,237 R569H probably damaging Het
Gabrg2 A T 11: 41,971,908 F116L probably damaging Het
Gm11555 T G 11: 99,649,759 R141S unknown Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm5415 A T 1: 32,545,853 H325Q probably damaging Het
Hectd3 T C 4: 116,995,689 I96T possibly damaging Het
Hnrnpul2 T A 19: 8,824,985 N405K probably damaging Het
Iigp1 A T 18: 60,389,888 K26I possibly damaging Het
Kirrel2 T C 7: 30,454,154 K260R probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt19 T C 11: 100,141,575 E260G probably damaging Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mthfd2l G T 5: 90,948,834 E105* probably null Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Ndufaf5 T C 2: 140,188,860 V222A probably benign Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Nsun7 T A 5: 66,261,219 Y97* probably null Het
Nxph3 T C 11: 95,514,164 Y17C probably benign Het
Olfr1110 A C 2: 87,136,246 V25G possibly damaging Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr586 A G 7: 103,121,908 M292T probably benign Het
Olfr728 A G 14: 50,140,619 S7P probably damaging Het
Olfr832 A T 9: 18,944,881 I78F probably damaging Het
P2rx2 A G 5: 110,342,879 F26S probably damaging Het
Pank1 A T 19: 34,827,363 L131Q probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppwd1 A G 13: 104,217,245 L335P probably damaging Het
Ptch1 A G 13: 63,513,671 S1218P probably damaging Het
Ptpn4 C T 1: 119,682,785 R664Q probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Slc22a19 C T 19: 7,683,850 V320M possibly damaging Het
Slc25a33 A T 4: 149,753,849 I122N probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Ttc12 A G 9: 49,441,835 probably null Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
R7733:BC005561 UTSW 5 104519960 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTTACAACAGCCATCCACTTTTAG -3'
(R):5'- TGCCTGCCTTTAACTGATTGG -3'

Sequencing Primer
(F):5'- TTAAAGCTTATACAATAGATCGAGCC -3'
(R):5'- TTGGCTACATACTGAAGAAGACC -3'
Posted On2014-10-15