Incidental Mutation 'R2226:Olfr167'
ID 239752
Institutional Source Beutler Lab
Gene Symbol Olfr167
Ensembl Gene ENSMUSG00000045341
Gene Name olfactory receptor 167
Synonyms MOR272-1, GA_x54KRFPKG5P-15963726-15962788
MMRRC Submission 040227-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R2226 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 19509558-19522266 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19515246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 130 (H130R)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
AlphaFold Q8VGJ5
Predicted Effect probably benign
Transcript: ENSMUST00000054606
AA Change: H130R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: H130R

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214315
AA Change: H130R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217566
Meta Mutation Damage Score 0.1493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A T 4: 144,463,725 V2E possibly damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Ascc3 A G 10: 50,754,052 T1746A probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
Atp1b3 A G 9: 96,343,276 F113S probably damaging Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc150 A G 1: 54,364,925 I943V probably null Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Efhb A T 17: 53,462,429 probably null Het
Elfn2 A G 15: 78,674,243 W35R probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Epha2 G A 4: 141,321,237 R569H probably damaging Het
Gabrg2 A T 11: 41,971,908 F116L probably damaging Het
Gm11555 T G 11: 99,649,759 R141S unknown Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm5415 A T 1: 32,545,853 H325Q probably damaging Het
Hectd3 T C 4: 116,995,689 I96T possibly damaging Het
Hnrnpul2 T A 19: 8,824,985 N405K probably damaging Het
Iigp1 A T 18: 60,389,888 K26I possibly damaging Het
Kirrel2 T C 7: 30,454,154 K260R probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt19 T C 11: 100,141,575 E260G probably damaging Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mthfd2l G T 5: 90,948,834 E105* probably null Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Ndufaf5 T C 2: 140,188,860 V222A probably benign Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Nsun7 T A 5: 66,261,219 Y97* probably null Het
Nxph3 T C 11: 95,514,164 Y17C probably benign Het
Olfr1110 A C 2: 87,136,246 V25G possibly damaging Het
Olfr586 A G 7: 103,121,908 M292T probably benign Het
Olfr728 A G 14: 50,140,619 S7P probably damaging Het
Olfr832 A T 9: 18,944,881 I78F probably damaging Het
P2rx2 A G 5: 110,342,879 F26S probably damaging Het
Pank1 A T 19: 34,827,363 L131Q probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppwd1 A G 13: 104,217,245 L335P probably damaging Het
Ptch1 A G 13: 63,513,671 S1218P probably damaging Het
Ptpn4 C T 1: 119,682,785 R664Q probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Slc22a19 C T 19: 7,683,850 V320M possibly damaging Het
Slc25a33 A T 4: 149,753,849 I122N probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Ttc12 A G 9: 49,441,835 probably null Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Olfr167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Olfr167 APN 16 19515478 missense probably benign 0.01
IGL02115:Olfr167 APN 16 19515103 missense probably damaging 1.00
IGL02562:Olfr167 APN 16 19514964 missense possibly damaging 0.74
BB008:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
BB018:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R0366:Olfr167 UTSW 16 19514848 missense probably benign 0.13
R0673:Olfr167 UTSW 16 19515396 missense probably damaging 1.00
R1187:Olfr167 UTSW 16 19515046 missense probably benign 0.01
R1237:Olfr167 UTSW 16 19515625 missense probably benign 0.01
R1975:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1977:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1997:Olfr167 UTSW 16 19515042 missense probably damaging 1.00
R2225:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R4078:Olfr167 UTSW 16 19515232 missense possibly damaging 0.76
R5019:Olfr167 UTSW 16 19515535 missense probably damaging 0.99
R5071:Olfr167 UTSW 16 19515027 missense probably benign 0.00
R5278:Olfr167 UTSW 16 19515378 nonsense probably null
R5415:Olfr167 UTSW 16 19515246 missense possibly damaging 0.94
R5744:Olfr167 UTSW 16 19515336 missense probably benign 0.00
R5991:Olfr167 UTSW 16 19514757 missense probably damaging 0.99
R6151:Olfr167 UTSW 16 19515531 missense probably damaging 1.00
R6540:Olfr167 UTSW 16 19514821 missense probably benign
R7014:Olfr167 UTSW 16 19515456 missense probably benign 0.20
R7145:Olfr167 UTSW 16 19514899 missense probably damaging 0.99
R7535:Olfr167 UTSW 16 19514794 missense probably damaging 1.00
R7677:Olfr167 UTSW 16 19514928 missense probably benign 0.42
R7715:Olfr167 UTSW 16 19514730 missense probably benign 0.00
R7931:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R8137:Olfr167 UTSW 16 19515096 missense possibly damaging 0.89
R8671:Olfr167 UTSW 16 19515054 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGCAAGCCAGAGTCAACATG -3'
(R):5'- GGTAACCTGTCCATGATCCTCC -3'

Sequencing Primer
(F):5'- TCAACATGGCAGGGACATC -3'
(R):5'- CCTGGATTCACATCTCCACAC -3'
Posted On 2014-10-15