Incidental Mutation 'R2226:Gm4985'
ID239764
Institutional Source Beutler Lab
Gene Symbol Gm4985
Ensembl Gene ENSMUSG00000090102
Gene Namepredicted gene 4985
Synonyms
MMRRC Submission 040227-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2226 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location23957702-23958934 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 23958934 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000112982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118300]
Predicted Effect probably null
Transcript: ENSMUST00000118300
AA Change: M1L

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112982
Gene: ENSMUSG00000090102
AA Change: M1L

DomainStartEndE-ValueType
Pfam:PET 86 185 4.7e-44 PFAM
LIM 224 281 1.48e-8 SMART
LIM 289 341 2e-14 SMART
LIM 349 404 2.52e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A T 4: 144,463,725 V2E possibly damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Ascc3 A G 10: 50,754,052 T1746A probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
Atp1b3 A G 9: 96,343,276 F113S probably damaging Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc150 A G 1: 54,364,925 I943V probably null Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Efhb A T 17: 53,462,429 probably null Het
Elfn2 A G 15: 78,674,243 W35R probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Epha2 G A 4: 141,321,237 R569H probably damaging Het
Gabrg2 A T 11: 41,971,908 F116L probably damaging Het
Gm11555 T G 11: 99,649,759 R141S unknown Het
Gm5415 A T 1: 32,545,853 H325Q probably damaging Het
Hectd3 T C 4: 116,995,689 I96T possibly damaging Het
Hnrnpul2 T A 19: 8,824,985 N405K probably damaging Het
Iigp1 A T 18: 60,389,888 K26I possibly damaging Het
Kirrel2 T C 7: 30,454,154 K260R probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt19 T C 11: 100,141,575 E260G probably damaging Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mthfd2l G T 5: 90,948,834 E105* probably null Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Ndufaf5 T C 2: 140,188,860 V222A probably benign Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Nsun7 T A 5: 66,261,219 Y97* probably null Het
Nxph3 T C 11: 95,514,164 Y17C probably benign Het
Olfr1110 A C 2: 87,136,246 V25G possibly damaging Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr586 A G 7: 103,121,908 M292T probably benign Het
Olfr728 A G 14: 50,140,619 S7P probably damaging Het
Olfr832 A T 9: 18,944,881 I78F probably damaging Het
P2rx2 A G 5: 110,342,879 F26S probably damaging Het
Pank1 A T 19: 34,827,363 L131Q probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppwd1 A G 13: 104,217,245 L335P probably damaging Het
Ptch1 A G 13: 63,513,671 S1218P probably damaging Het
Ptpn4 C T 1: 119,682,785 R664Q probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Slc22a19 C T 19: 7,683,850 V320M possibly damaging Het
Slc25a33 A T 4: 149,753,849 I122N probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Ttc12 A G 9: 49,441,835 probably null Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Gm4985
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Gm4985 APN X 23957952 missense probably benign 0.17
IGL02026:Gm4985 APN X 23957994 missense probably damaging 1.00
R2224:Gm4985 UTSW X 23958934 start codon destroyed probably null 0.16
R2227:Gm4985 UTSW X 23958934 start codon destroyed probably null 0.16
R2253:Gm4985 UTSW X 23958711 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGTCTTCAAGTAGTCTCTCC -3'
(R):5'- TGGAATTAGAAGTGTGATCTATCGAGG -3'

Sequencing Primer
(F):5'- TCAAGTAGTCTCTCCATTTTCCG -3'
(R):5'- GCCTTTAATCCCAGCACTAGAGAGG -3'
Posted On2014-10-15