Mutagenetix > Incidental Mutations

Incidental Mutation 'R2227:Lpar5'

239784

Institutional Source

Beutler Lab

Gene Symbol

Lpar5

Ensembl Gene

ENSMUSG00000067714

Gene Name

lysophosphatidic acid receptor 5

Synonyms

LPA5, LOC381810, Gpr92, GPR93

MMRRC Submission

040228-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R2227 (G1)

Quality Score

203

Status

Not validated

Chromosome

Chromosomal Location

125067920-125082472 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 125081135 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088292] [ENSMUST00000140346] [ENSMUST00000171989]

Predicted Effect

probably null
Transcript: ENSMUST00000088292

SMART Domains

Protein: ENSMUSP00000085630
Gene: ENSMUSG00000067714

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:7tm_1	55	313	7.4e-40	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000140346

SMART Domains

Protein: ENSMUSP00000119904
Gene: ENSMUSG00000067714

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:7tm_1	55	164	1.5e-30	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000171989

SMART Domains

Protein: ENSMUSP00000132511
Gene: ENSMUSG00000067714

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:7tm_1	55	313	1.1e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203956

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to neuropathic pain and myelin sheath alterations. Mice homozygous for a different targeted allele exhibit decreased nociception sensitivity, decreased anxiety-related response and enhanced coordination and spatial learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563I02Rik	T	A	14: 60,088,219		probably benign	Het
Abtb1	A	C	6: 88,836,367	L439R	probably damaging	Het
Adcy10	A	G	1: 165,518,260	T293A	probably damaging	Het
Agl	A	T	3: 116,788,312	V306D	possibly damaging	Het
Alpk2	T	A	18: 65,378,076	T17S	probably damaging	Het
Ar	T	A	X: 98,151,331	M517K	probably benign	Het
Atg9b	A	G	5: 24,386,395	V735A	possibly damaging	Het
BB014433	C	A	8: 15,041,717	A379S	probably benign	Het
BC005561	T	A	5: 104,519,420	Y603N	probably damaging	Het
Ccdc33	A	G	9: 58,082,022	S123P	probably damaging	Het
Ccl2	G	T	11: 82,036,601		probably null	Het
Cct2	T	C	10: 117,053,017	R526G	probably null	Het
Cep55	T	C	19: 38,062,634	M164T	probably benign	Het
Clec2d	G	A	6: 129,184,251	A104T	probably benign	Het
Cyp3a11	A	G	5: 145,868,547	L220P	possibly damaging	Het
Dgkk	T	A	X: 6,875,248	D102E	probably damaging	Het
Emcn	T	C	3: 137,404,017	I140T	possibly damaging	Het
Exoc2	T	A	13: 30,864,884	I729L	probably benign	Het
Fbxl20	T	C	11: 98,090,849	I338V	probably benign	Het
Gm4985	T	A	X: 23,958,934	M1L	probably null	Het
Gm6614	T	G	6: 141,992,361	E277D	possibly damaging	Het
Gucy2c	G	A	6: 136,702,760	T943I	probably damaging	Het
Hdac9	C	T	12: 34,407,802	V251I	probably benign	Het
Hoxa10	T	C	6: 52,232,636	E52G	probably damaging	Het
Il17rb	A	T	14: 30,006,081	S56R	probably benign	Het
Knl1	A	G	2: 119,072,000	D1394G	probably damaging	Het
Kpna1	G	A	16: 36,031,221	A392T	probably damaging	Het
Krt6b	A	G	15: 101,679,122	V179A	probably damaging	Het
March7	A	G	2: 60,229,846	R106G	probably benign	Het
Mtus1	C	T	8: 41,082,775	V635M	probably damaging	Het
Myl1	T	C	1: 66,944,815	K31E	possibly damaging	Het
Myt1l	T	A	12: 29,826,970	L207I	unknown	Het
Naalad2	A	T	9: 18,376,533	V267E	possibly damaging	Het
Pkhd1l1	T	C	15: 44,512,792	I950T	possibly damaging	Het
Ppp1r9a	G	T	6: 5,154,074	R1081L	probably benign	Het
Rc3h1	T	C	1: 160,963,542	I932T	probably benign	Het
Rubcnl	G	A	14: 75,042,392	R405Q	probably benign	Het
Sgsm3	A	G	15: 81,003,868	E53G	probably damaging	Het
Spin2g	A	T	X: 34,237,275	I171N	possibly damaging	Het
Srsf6	G	A	2: 162,931,699	S10N	probably damaging	Het
Tex45	A	G	8: 3,479,249	T245A	probably benign	Het
Tnn	A	T	1: 160,147,465	C131S	probably damaging	Het
Tnnt2	A	G	1: 135,843,791		probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Vmn1r86	T	C	7: 13,102,920	I10V	probably benign	Het
Xpot	T	C	10: 121,622,860	R20G	probably damaging	Het
Zfp735	T	A	11: 73,711,396	L389I	possibly damaging	Het
Zfp735	T	G	11: 73,711,397	L389*	probably null	Het

Other mutations in Lpar5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01719:Lpar5	APN	6	125082006	missense	possibly damaging	0.94
IGL01830:Lpar5	APN	6	125081822	missense	probably benign	0.01
IGL01975:Lpar5	APN	6	125081787	missense	probably damaging	0.99
IGL02021:Lpar5	APN	6	125081992	nonsense	probably null
IGL02718:Lpar5	APN	6	125082244	missense	probably damaging	1.00
IGL03027:Lpar5	APN	6	125082240	missense	probably damaging	1.00
IGL03300:Lpar5	APN	6	125082240	missense	probably damaging	1.00
F5770:Lpar5	UTSW	6	125081727	missense	possibly damaging	0.88
R0633:Lpar5	UTSW	6	125081991	missense	probably benign	0.25
R1639:Lpar5	UTSW	6	125081601	missense	probably damaging	1.00
R1822:Lpar5	UTSW	6	125081415	missense	possibly damaging	0.76
R4019:Lpar5	UTSW	6	125081675	missense	probably damaging	1.00
R4288:Lpar5	UTSW	6	125081864	missense	probably benign	0.00
R4705:Lpar5	UTSW	6	125082207	missense	possibly damaging	0.64
R4787:Lpar5	UTSW	6	125082498	unclassified	probably null
R5027:Lpar5	UTSW	6	125082147	missense	possibly damaging	0.69
R6114:Lpar5	UTSW	6	125081676	missense	probably damaging	1.00
R7197:Lpar5	UTSW	6	125082384	missense	probably benign	0.00
R7779:Lpar5	UTSW	6	125082244	missense	probably damaging	1.00
R8193:Lpar5	UTSW	6	125081339	missense	probably benign
R8264:Lpar5	UTSW	6	125081502	missense	probably damaging	1.00
V7580:Lpar5	UTSW	6	125081727	missense	possibly damaging	0.88
V7581:Lpar5	UTSW	6	125081727	missense	possibly damaging	0.88
V7582:Lpar5	UTSW	6	125081727	missense	possibly damaging	0.88
Z1176:Lpar5	UTSW	6	125081379	missense	possibly damaging	0.92
Z1176:Lpar5	UTSW	6	125082072	missense	probably damaging	1.00
Z1177:Lpar5	UTSW	6	125082018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACCTGGGCATGACAATGTAGG -3'
(R):5'- AACATCATGTCCAGGTGGG -3'

Sequencing Primer
(F):5'- CCTGGGCATGACAATGTAGGATAGAG -3'
(R):5'- TTAGTCTGAGGCATCGTAGGGAAC -3'

Posted On

2014-10-15