Incidental Mutation 'R2227:Lpar5'
ID 239784
Institutional Source Beutler Lab
Gene Symbol Lpar5
Ensembl Gene ENSMUSG00000067714
Gene Name lysophosphatidic acid receptor 5
Synonyms LPA5, LOC381810, Gpr92, GPR93
MMRRC Submission 040228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2227 (G1)
Quality Score 203
Status Not validated
Chromosome 6
Chromosomal Location 125067920-125082472 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 125081135 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088292] [ENSMUST00000140346] [ENSMUST00000171989]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000088292
SMART Domains Protein: ENSMUSP00000085630
Gene: ENSMUSG00000067714

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 7.4e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140346
SMART Domains Protein: ENSMUSP00000119904
Gene: ENSMUSG00000067714

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 164 1.5e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171989
SMART Domains Protein: ENSMUSP00000132511
Gene: ENSMUSG00000067714

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203956
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to neuropathic pain and myelin sheath alterations. Mice homozygous for a different targeted allele exhibit decreased nociception sensitivity, decreased anxiety-related response and enhanced coordination and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T A 14: 60,088,219 probably benign Het
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Agl A T 3: 116,788,312 V306D possibly damaging Het
Alpk2 T A 18: 65,378,076 T17S probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BB014433 C A 8: 15,041,717 A379S probably benign Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Ccl2 G T 11: 82,036,601 probably null Het
Cct2 T C 10: 117,053,017 R526G probably null Het
Cep55 T C 19: 38,062,634 M164T probably benign Het
Clec2d G A 6: 129,184,251 A104T probably benign Het
Cyp3a11 A G 5: 145,868,547 L220P possibly damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exoc2 T A 13: 30,864,884 I729L probably benign Het
Fbxl20 T C 11: 98,090,849 I338V probably benign Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm6614 T G 6: 141,992,361 E277D possibly damaging Het
Gucy2c G A 6: 136,702,760 T943I probably damaging Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17rb A T 14: 30,006,081 S56R probably benign Het
Knl1 A G 2: 119,072,000 D1394G probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt6b A G 15: 101,679,122 V179A probably damaging Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Myl1 T C 1: 66,944,815 K31E possibly damaging Het
Myt1l T A 12: 29,826,970 L207I unknown Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Rc3h1 T C 1: 160,963,542 I932T probably benign Het
Rubcnl G A 14: 75,042,392 R405Q probably benign Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn1r86 T C 7: 13,102,920 I10V probably benign Het
Xpot T C 10: 121,622,860 R20G probably damaging Het
Zfp735 T A 11: 73,711,396 L389I possibly damaging Het
Zfp735 T G 11: 73,711,397 L389* probably null Het
Other mutations in Lpar5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Lpar5 APN 6 125082006 missense possibly damaging 0.94
IGL01830:Lpar5 APN 6 125081822 missense probably benign 0.01
IGL01975:Lpar5 APN 6 125081787 missense probably damaging 0.99
IGL02021:Lpar5 APN 6 125081992 nonsense probably null
IGL02718:Lpar5 APN 6 125082244 missense probably damaging 1.00
IGL03027:Lpar5 APN 6 125082240 missense probably damaging 1.00
IGL03300:Lpar5 APN 6 125082240 missense probably damaging 1.00
F5770:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
R0633:Lpar5 UTSW 6 125081991 missense probably benign 0.25
R1639:Lpar5 UTSW 6 125081601 missense probably damaging 1.00
R1822:Lpar5 UTSW 6 125081415 missense possibly damaging 0.76
R4019:Lpar5 UTSW 6 125081675 missense probably damaging 1.00
R4288:Lpar5 UTSW 6 125081864 missense probably benign 0.00
R4705:Lpar5 UTSW 6 125082207 missense possibly damaging 0.64
R4787:Lpar5 UTSW 6 125082498 splice site probably null
R5027:Lpar5 UTSW 6 125082147 missense possibly damaging 0.69
R6114:Lpar5 UTSW 6 125081676 missense probably damaging 1.00
R7197:Lpar5 UTSW 6 125082384 missense probably benign 0.00
R7779:Lpar5 UTSW 6 125082244 missense probably damaging 1.00
R8193:Lpar5 UTSW 6 125081339 missense probably benign
R8264:Lpar5 UTSW 6 125081502 missense probably damaging 1.00
R9460:Lpar5 UTSW 6 125081271 start gained probably benign
V7580:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7581:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7582:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
Z1176:Lpar5 UTSW 6 125081379 missense possibly damaging 0.92
Z1176:Lpar5 UTSW 6 125082072 missense probably damaging 1.00
Z1177:Lpar5 UTSW 6 125082018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTGGGCATGACAATGTAGG -3'
(R):5'- AACATCATGTCCAGGTGGG -3'

Sequencing Primer
(F):5'- CCTGGGCATGACAATGTAGGATAGAG -3'
(R):5'- TTAGTCTGAGGCATCGTAGGGAAC -3'
Posted On 2014-10-15