Incidental Mutation 'R2227:Lpar5'
ID 239784
Institutional Source Beutler Lab
Gene Symbol Lpar5
Ensembl Gene ENSMUSG00000067714
Gene Name lysophosphatidic acid receptor 5
Synonyms Gpr92, LOC381810, GPR93, LPA5
MMRRC Submission 040228-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R2227 (G1)
Quality Score 203
Status Not validated
Chromosome 6
Chromosomal Location 125044883-125059435 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 125058098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088292] [ENSMUST00000140346] [ENSMUST00000171989]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000088292
SMART Domains Protein: ENSMUSP00000085630
Gene: ENSMUSG00000067714

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 7.4e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140346
SMART Domains Protein: ENSMUSP00000119904
Gene: ENSMUSG00000067714

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 164 1.5e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171989
SMART Domains Protein: ENSMUSP00000132511
Gene: ENSMUSG00000067714

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203956
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to neuropathic pain and myelin sheath alterations. Mice homozygous for a different targeted allele exhibit decreased nociception sensitivity, decreased anxiety-related response and enhanced coordination and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T A 14: 60,325,668 (GRCm39) probably benign Het
Abtb1 A C 6: 88,813,349 (GRCm39) L439R probably damaging Het
Adcy10 A G 1: 165,345,829 (GRCm39) T293A probably damaging Het
Agl A T 3: 116,581,961 (GRCm39) V306D possibly damaging Het
Alpk2 T A 18: 65,511,147 (GRCm39) T17S probably damaging Het
Ar T A X: 97,194,937 (GRCm39) M517K probably benign Het
Atg9b A G 5: 24,591,393 (GRCm39) V735A possibly damaging Het
BB014433 C A 8: 15,091,717 (GRCm39) A379S probably benign Het
Ccdc33 A G 9: 57,989,305 (GRCm39) S123P probably damaging Het
Ccl2 G T 11: 81,927,427 (GRCm39) probably null Het
Cct2 T C 10: 116,888,922 (GRCm39) R526G probably null Het
Cep55 T C 19: 38,051,082 (GRCm39) M164T probably benign Het
Clec2d G A 6: 129,161,214 (GRCm39) A104T probably benign Het
Cyp3a11 A G 5: 145,805,357 (GRCm39) L220P possibly damaging Het
Dgkk T A X: 6,741,487 (GRCm39) D102E probably damaging Het
Emcn T C 3: 137,109,778 (GRCm39) I140T possibly damaging Het
Exoc2 T A 13: 31,048,867 (GRCm39) I729L probably benign Het
Fbxl20 T C 11: 97,981,675 (GRCm39) I338V probably benign Het
Gucy2c G A 6: 136,679,758 (GRCm39) T943I probably damaging Het
Hdac9 C T 12: 34,457,801 (GRCm39) V251I probably benign Het
Hoxa10 T C 6: 52,209,616 (GRCm39) E52G probably damaging Het
Il17rb A T 14: 29,728,038 (GRCm39) S56R probably benign Het
Knl1 A G 2: 118,902,481 (GRCm39) D1394G probably damaging Het
Kpna1 G A 16: 35,851,591 (GRCm39) A392T probably damaging Het
Krt6b A G 15: 101,587,557 (GRCm39) V179A probably damaging Het
Marchf7 A G 2: 60,060,190 (GRCm39) R106G probably benign Het
Mtus1 C T 8: 41,535,812 (GRCm39) V635M probably damaging Het
Myl1 T C 1: 66,983,974 (GRCm39) K31E possibly damaging Het
Myt1l T A 12: 29,876,969 (GRCm39) L207I unknown Het
Naalad2 A T 9: 18,287,829 (GRCm39) V267E possibly damaging Het
Pkhd1l1 T C 15: 44,376,188 (GRCm39) I950T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 (GRCm39) R1081L probably benign Het
Rc3h1 T C 1: 160,791,112 (GRCm39) I932T probably benign Het
Rubcnl G A 14: 75,279,832 (GRCm39) R405Q probably benign Het
Saxo5 A G 8: 3,529,249 (GRCm39) T245A probably benign Het
Sgsm3 A G 15: 80,888,069 (GRCm39) E53G probably damaging Het
Slco1a8 T G 6: 141,938,087 (GRCm39) E277D possibly damaging Het
Spin2g A T X: 33,656,599 (GRCm39) I171N possibly damaging Het
Srsf6 G A 2: 162,773,619 (GRCm39) S10N probably damaging Het
Tesl2 T A X: 23,825,173 (GRCm39) M1L probably null Het
Thoc2l T A 5: 104,667,286 (GRCm39) Y603N probably damaging Het
Tnn A T 1: 159,975,035 (GRCm39) C131S probably damaging Het
Tnnt2 A G 1: 135,771,529 (GRCm39) probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Vmn1r86 T C 7: 12,836,847 (GRCm39) I10V probably benign Het
Xpot T C 10: 121,458,765 (GRCm39) R20G probably damaging Het
Zfp735 T A 11: 73,602,222 (GRCm39) L389I possibly damaging Het
Zfp735 T G 11: 73,602,223 (GRCm39) L389* probably null Het
Other mutations in Lpar5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Lpar5 APN 6 125,058,969 (GRCm39) missense possibly damaging 0.94
IGL01830:Lpar5 APN 6 125,058,785 (GRCm39) missense probably benign 0.01
IGL01975:Lpar5 APN 6 125,058,750 (GRCm39) missense probably damaging 0.99
IGL02021:Lpar5 APN 6 125,058,955 (GRCm39) nonsense probably null
IGL02718:Lpar5 APN 6 125,059,207 (GRCm39) missense probably damaging 1.00
IGL03027:Lpar5 APN 6 125,059,203 (GRCm39) missense probably damaging 1.00
IGL03300:Lpar5 APN 6 125,059,203 (GRCm39) missense probably damaging 1.00
F5770:Lpar5 UTSW 6 125,058,690 (GRCm39) missense possibly damaging 0.88
R0633:Lpar5 UTSW 6 125,058,954 (GRCm39) missense probably benign 0.25
R1639:Lpar5 UTSW 6 125,058,564 (GRCm39) missense probably damaging 1.00
R1822:Lpar5 UTSW 6 125,058,378 (GRCm39) missense possibly damaging 0.76
R4019:Lpar5 UTSW 6 125,058,638 (GRCm39) missense probably damaging 1.00
R4288:Lpar5 UTSW 6 125,058,827 (GRCm39) missense probably benign 0.00
R4705:Lpar5 UTSW 6 125,059,170 (GRCm39) missense possibly damaging 0.64
R4787:Lpar5 UTSW 6 125,059,461 (GRCm39) splice site probably null
R5027:Lpar5 UTSW 6 125,059,110 (GRCm39) missense possibly damaging 0.69
R6114:Lpar5 UTSW 6 125,058,639 (GRCm39) missense probably damaging 1.00
R7197:Lpar5 UTSW 6 125,059,347 (GRCm39) missense probably benign 0.00
R7779:Lpar5 UTSW 6 125,059,207 (GRCm39) missense probably damaging 1.00
R8193:Lpar5 UTSW 6 125,058,302 (GRCm39) missense probably benign
R8264:Lpar5 UTSW 6 125,058,465 (GRCm39) missense probably damaging 1.00
R9460:Lpar5 UTSW 6 125,058,234 (GRCm39) start gained probably benign
R9628:Lpar5 UTSW 6 125,058,948 (GRCm39) missense probably damaging 0.96
V7580:Lpar5 UTSW 6 125,058,690 (GRCm39) missense possibly damaging 0.88
V7581:Lpar5 UTSW 6 125,058,690 (GRCm39) missense possibly damaging 0.88
V7582:Lpar5 UTSW 6 125,058,690 (GRCm39) missense possibly damaging 0.88
Z1176:Lpar5 UTSW 6 125,059,035 (GRCm39) missense probably damaging 1.00
Z1176:Lpar5 UTSW 6 125,058,342 (GRCm39) missense possibly damaging 0.92
Z1177:Lpar5 UTSW 6 125,058,981 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTGGGCATGACAATGTAGG -3'
(R):5'- AACATCATGTCCAGGTGGG -3'

Sequencing Primer
(F):5'- CCTGGGCATGACAATGTAGGATAGAG -3'
(R):5'- TTAGTCTGAGGCATCGTAGGGAAC -3'
Posted On 2014-10-15