Mutagenetix > Incidental Mutations

Incidental Mutation 'R0184:Bicc1'

23979

Institutional Source

Beutler Lab

Gene Symbol

Bicc1

Ensembl Gene

ENSMUSG00000014329

Gene Name

BicC family RNA binding protein 1

Synonyms

Bic-C, jcpk

MMRRC Submission

038449-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0184 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70922832-71159700 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 71079215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 73 (R73L)

Ref Sequence

ENSEMBL: ENSMUSP00000123201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]

AlphaFold

Q99MQ1

Predicted Effect

probably benign
Transcript: ENSMUST00000014473
AA Change: R73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: R73L

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131445

SMART Domains

Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329

Domain	Start	End	E-Value	Type
SCOP:d1dtja_	1	46	1e-2	SMART
Blast:KH	1	47	1e-22	BLAST
KH	51	124	6.24e-18	SMART
KH	203	273	1.25e-8	SMART
low complexity region	302	320	N/A	INTRINSIC
low complexity region	365	385	N/A	INTRINSIC
low complexity region	398	417	N/A	INTRINSIC
low complexity region	618	636	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	712	733	N/A	INTRINSIC
SAM	790	856	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143791
AA Change: R73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: R73L

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	4.26e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160178

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.9%

Validation Efficiency

66% (50/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	A	3: 124,419,250	V131F	probably damaging	Het
Adam28	T	C	14: 68,637,373	D285G	probably benign	Het
Akr1c13	A	G	13: 4,194,056	E36G	probably damaging	Het
Antxr2	A	G	5: 97,980,030	L214S	probably damaging	Het
Arhgap26	T	A	18: 38,617,673	D46E	unknown	Het
Armc9	T	C	1: 86,198,370	L61P	probably damaging	Het
Calm2	T	C	17: 87,435,841	N43S	probably benign	Het
Cct7	A	G	6: 85,461,554	D105G	probably null	Het
Cdk18	T	C	1: 132,118,538	N215D	probably benign	Het
Cep126	T	C	9: 8,103,395	T205A	probably benign	Het
Cfap57	A	T	4: 118,599,012	I495N	probably damaging	Het
Cyp2b9	T	A	7: 26,187,007	C152*	probably null	Het
Dab2ip	G	A	2: 35,718,791	R579H	probably damaging	Het
Dnah8	T	C	17: 30,683,683	V905A	probably benign	Het
Eif4h	C	A	5: 134,625,375	D134Y	possibly damaging	Het
Espl1	T	A	15: 102,299,216	S372T	probably benign	Het
Fat2	T	A	11: 55,296,288	H1244L	probably damaging	Het
Fbxo11	T	A	17: 88,008,673	N443I	probably benign	Het
Git2	G	A	5: 114,739,037	T128M	possibly damaging	Het
Gm10985	T	A	3: 53,845,258	Y21N	probably damaging	Het
Gm12790	A	T	4: 101,967,614	Y152*	probably null	Het
Heatr5a	T	C	12: 51,909,969	D1115G	probably benign	Het
Hipk2	T	C	6: 38,718,931	N726S	possibly damaging	Het
Hrg	T	C	16: 22,953,771		probably null	Het
Iars	T	G	13: 49,722,212	S792A	probably benign	Het
Igf1r	A	G	7: 68,226,193	N1301S	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Ilkap	T	C	1: 91,376,305		probably benign	Het
Ints13	A	T	6: 146,555,044	Y435N	probably benign	Het
Ints8	A	C	4: 11,218,637	S797A	probably benign	Het
Itgad	T	A	7: 128,189,231	D405E	probably benign	Het
Itgam	A	T	7: 128,086,058	I448F	probably damaging	Het
Klk1	C	T	7: 44,228,749	T41I	possibly damaging	Het
Mcrip1	T	C	11: 120,544,884	M1V	probably null	Het
Mdga1	A	G	17: 29,852,442	Y128H	probably damaging	Het
Mtor	G	T	4: 148,464,971	R604L	probably benign	Het
Olfr1170	A	T	2: 88,224,780	L84*	probably null	Het
Olfr656	T	C	7: 104,618,240	V187A	probably damaging	Het
Pcdhb7	T	A	18: 37,343,390	D526E	probably benign	Het
Pip4k2a	T	C	2: 18,889,128	D139G	probably damaging	Het
Pkp3	A	C	7: 141,088,367	N536T	probably benign	Het
Pla2g4c	T	A	7: 13,356,220	S524T	probably benign	Het
Pno1	T	C	11: 17,211,127	E69G	probably benign	Het
Pold1	C	T	7: 44,541,715	V231M	probably benign	Het
Poli	A	G	18: 70,522,731	S248P	probably damaging	Het
Ppox	C	T	1: 171,279,552	S138N	probably damaging	Het
Psg20	T	C	7: 18,685,976	E6G	probably null	Het
Rbmx	C	T	X: 57,391,566		probably null	Het
Rln1	T	A	19: 29,331,936	K148*	probably null	Het
Rnf213	C	T	11: 119,414,521	T526I	probably damaging	Het
Rps6kc1	A	T	1: 190,799,093	V904E	probably null	Het
Sf3b2	T	A	19: 5,283,672	I633F	probably damaging	Het
Sfswap	T	A	5: 129,507,189	I189N	probably damaging	Het
Smarca2	T	A	19: 26,692,249	Y973*	probably null	Het
Spink5	G	A	18: 44,003,198	D559N	probably benign	Het
Spty2d1	C	T	7: 46,997,574	V536I	possibly damaging	Het
Tbx3	T	C	5: 119,675,562	I221T	probably damaging	Het
Tcf20	T	A	15: 82,852,300	D1650V	probably damaging	Het
Thsd7b	A	G	1: 129,430,964	K45R	probably benign	Het
Tirap	A	G	9: 35,189,194	S65P	probably benign	Het
Trim25	C	T	11: 88,999,640	P51L	probably damaging	Het
Trim61	T	C	8: 65,014,417	N64S	probably benign	Het
Twf1	T	A	15: 94,581,067		probably null	Het
Ubr4	A	C	4: 139,445,262	T1692P	probably damaging	Het
Usp3	A	G	9: 66,562,581	M86T	probably damaging	Het
Utrn	T	C	10: 12,667,618	D1762G	probably benign	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Vmn2r52	T	C	7: 10,159,338	S625G	probably damaging	Het
Vmn2r90	G	A	17: 17,726,877	W472*	probably null	Het
Vrk2	C	A	11: 26,550,046	A56S	probably damaging	Het
Yeats2	C	T	16: 20,203,685	P620S	possibly damaging	Het
Zbtb21	C	T	16: 97,950,513	D171N	probably damaging	Het
Zeb1	A	T	18: 5,766,808	I440F	probably damaging	Het
Zfp292	A	G	4: 34,819,563	I253T	probably damaging	Het

Other mutations in Bicc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Bicc1	APN	10	70961157	missense	probably damaging	1.00
IGL01988:Bicc1	APN	10	70956176	missense	probably damaging	1.00
IGL02686:Bicc1	APN	10	70943360	splice site	probably benign
IGL02829:Bicc1	APN	10	70958880	missense	probably damaging	1.00
IGL03276:Bicc1	APN	10	70953438	missense	possibly damaging	0.76
IGL03354:Bicc1	APN	10	70946602	missense	probably benign	0.00
artemis	UTSW	10	71027954	missense	probably damaging	0.99
Pebbles	UTSW	10	70947900	missense	possibly damaging	0.95
PIT1430001:Bicc1	UTSW	10	70957681	missense	possibly damaging	0.94
R0095:Bicc1	UTSW	10	70961158	missense	probably damaging	1.00
R0142:Bicc1	UTSW	10	70925370	missense	probably damaging	1.00
R0469:Bicc1	UTSW	10	71079215	missense	probably benign
R0485:Bicc1	UTSW	10	70925315	missense	probably damaging	0.96
R0520:Bicc1	UTSW	10	70957190	missense	probably damaging	0.96
R0884:Bicc1	UTSW	10	70958847	missense	probably damaging	1.00
R1678:Bicc1	UTSW	10	70943518	missense	probably damaging	1.00
R1892:Bicc1	UTSW	10	70958784	missense	probably damaging	1.00
R1943:Bicc1	UTSW	10	71159523	missense	probably damaging	1.00
R2220:Bicc1	UTSW	10	70950125	missense	probably damaging	1.00
R2240:Bicc1	UTSW	10	70946803	critical splice donor site	probably null
R2519:Bicc1	UTSW	10	70930644	missense	probably damaging	1.00
R4362:Bicc1	UTSW	10	70943374	frame shift	probably null
R4363:Bicc1	UTSW	10	70943374	frame shift	probably null
R4419:Bicc1	UTSW	10	70946974	missense	possibly damaging	0.73
R4697:Bicc1	UTSW	10	70953484	missense	possibly damaging	0.87
R4728:Bicc1	UTSW	10	70935831	critical splice donor site	probably null
R4765:Bicc1	UTSW	10	70940593	missense	probably damaging	1.00
R4838:Bicc1	UTSW	10	70945316	missense	possibly damaging	0.50
R5022:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5023:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5057:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5082:Bicc1	UTSW	10	70940522	missense	probably benign	0.05
R5160:Bicc1	UTSW	10	70932236	missense	probably damaging	1.00
R5294:Bicc1	UTSW	10	70947900	missense	possibly damaging	0.95
R5639:Bicc1	UTSW	10	70940520	missense	probably damaging	1.00
R5749:Bicc1	UTSW	10	70946969	missense	probably benign	0.00
R6045:Bicc1	UTSW	10	70957081	nonsense	probably null
R6128:Bicc1	UTSW	10	70940483	splice site	probably null
R6277:Bicc1	UTSW	10	71027901	missense	possibly damaging	0.74
R6389:Bicc1	UTSW	10	70958922	missense	probably damaging	1.00
R7021:Bicc1	UTSW	10	70961148	missense	probably damaging	0.99
R7101:Bicc1	UTSW	10	70930653	missense	probably damaging	1.00
R7351:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7352:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7353:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7366:Bicc1	UTSW	10	70943386	missense	probably benign	0.01
R7480:Bicc1	UTSW	10	70943476	missense	probably damaging	1.00
R7541:Bicc1	UTSW	10	70946604	missense	possibly damaging	0.82
R7544:Bicc1	UTSW	10	70956374	missense	possibly damaging	0.89
R7555:Bicc1	UTSW	10	70956291	missense	possibly damaging	0.75
R7663:Bicc1	UTSW	10	70946590	missense	probably benign
R7671:Bicc1	UTSW	10	70957167	missense	probably benign	0.01
R7747:Bicc1	UTSW	10	70946993	missense	probably benign
R8129:Bicc1	UTSW	10	71079203	missense	probably benign	0.01
R8270:Bicc1	UTSW	10	70932108	missense	probably damaging	0.99
R8525:Bicc1	UTSW	10	70943535	missense	possibly damaging	0.67
R8762:Bicc1	UTSW	10	70943386	missense	probably benign	0.03
R8849:Bicc1	UTSW	10	70946864	missense	probably benign	0.23
R9120:Bicc1	UTSW	10	70941032	missense	probably damaging	1.00
R9164:Bicc1	UTSW	10	70945264	missense	probably damaging	1.00
R9368:Bicc1	UTSW	10	70950087	missense	probably benign	0.13
RF013:Bicc1	UTSW	10	70935830	critical splice donor site	probably null
X0028:Bicc1	UTSW	10	70945336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCACTTGTTACAAAACCCAGCCC -3'
(R):5'- GCTTCCATCTAGCATGGAGACAGAC -3'

Sequencing Primer
(F):5'- CAGACACGGTTTGAGCATC -3'
(R):5'- GGGTCTTCCACTTAATCAAGAATGG -3'

Posted On

2013-04-16