Incidental Mutation 'R2227:Fbxl20'
ID239803
Institutional Source Beutler Lab
Gene Symbol Fbxl20
Ensembl Gene ENSMUSG00000020883
Gene NameF-box and leucine-rich repeat protein 20
Synonyms2610511F20Rik, C86145, 4632423N09Rik, Fbl2, Scrapper, Scr
MMRRC Submission 040228-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R2227 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98082556-98150403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98090849 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 338 (I338V)
Ref Sequence ENSEMBL: ENSMUSP00000099432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103143] [ENSMUST00000147971]
Predicted Effect probably benign
Transcript: ENSMUST00000103143
AA Change: I338V

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099432
Gene: ENSMUSG00000020883
AA Change: I338V

DomainStartEndE-ValueType
FBOX 28 68 2.62e-8 SMART
LRR 90 115 2.02e-1 SMART
LRR 116 141 1.77e1 SMART
LRR 142 167 7.9e-4 SMART
LRR_CC 168 193 4.61e-5 SMART
LRR 194 219 7.15e-2 SMART
LRR 220 245 1.67e-2 SMART
LRR 246 271 1.2e-3 SMART
LRR 272 297 2.61e-4 SMART
LRR 298 323 1.26e-2 SMART
LRR_CC 324 349 1.77e-6 SMART
LRR 353 377 6.06e2 SMART
LRR 378 403 2.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135969
Predicted Effect probably benign
Transcript: ENSMUST00000147971
SMART Domains Protein: ENSMUSP00000123507
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
LRR 14 39 7.15e-2 SMART
LRR 40 65 1.67e-2 SMART
LRR 66 91 1.2e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL20, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, shortened lifespans, decreased body size and altered CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T A 14: 60,088,219 probably benign Het
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Agl A T 3: 116,788,312 V306D possibly damaging Het
Alpk2 T A 18: 65,378,076 T17S probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BB014433 C A 8: 15,041,717 A379S probably benign Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Ccl2 G T 11: 82,036,601 probably null Het
Cct2 T C 10: 117,053,017 R526G probably null Het
Cep55 T C 19: 38,062,634 M164T probably benign Het
Clec2d G A 6: 129,184,251 A104T probably benign Het
Cyp3a11 A G 5: 145,868,547 L220P possibly damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exoc2 T A 13: 30,864,884 I729L probably benign Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm6614 T G 6: 141,992,361 E277D possibly damaging Het
Gucy2c G A 6: 136,702,760 T943I probably damaging Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17rb A T 14: 30,006,081 S56R probably benign Het
Knl1 A G 2: 119,072,000 D1394G probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt6b A G 15: 101,679,122 V179A probably damaging Het
Lpar5 A T 6: 125,081,135 probably null Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Myl1 T C 1: 66,944,815 K31E possibly damaging Het
Myt1l T A 12: 29,826,970 L207I unknown Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Rc3h1 T C 1: 160,963,542 I932T probably benign Het
Rubcnl G A 14: 75,042,392 R405Q probably benign Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn1r86 T C 7: 13,102,920 I10V probably benign Het
Xpot T C 10: 121,622,860 R20G probably damaging Het
Zfp735 T A 11: 73,711,396 L389I possibly damaging Het
Zfp735 T G 11: 73,711,397 L389* probably null Het
Other mutations in Fbxl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00161:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00590:Fbxl20 APN 11 98093129 missense probably damaging 1.00
IGL00944:Fbxl20 APN 11 98113242 missense probably damaging 1.00
IGL00966:Fbxl20 APN 11 98110974 missense probably damaging 1.00
IGL01344:Fbxl20 APN 11 98100100 nonsense probably null
IGL02394:Fbxl20 APN 11 98113256 missense probably damaging 1.00
R0270:Fbxl20 UTSW 11 98098503 splice site probably benign
R1564:Fbxl20 UTSW 11 98098486 missense probably damaging 1.00
R3902:Fbxl20 UTSW 11 98097035 missense probably benign 0.03
R4158:Fbxl20 UTSW 11 98095394 unclassified probably benign
R4516:Fbxl20 UTSW 11 98095235 unclassified probably benign
R4916:Fbxl20 UTSW 11 98128360 missense probably damaging 1.00
R5905:Fbxl20 UTSW 11 98115445 missense probably damaging 1.00
R6791:Fbxl20 UTSW 11 98109510 missense probably benign 0.05
R6916:Fbxl20 UTSW 11 98113253 missense possibly damaging 0.78
R7381:Fbxl20 UTSW 11 98090788 missense probably benign 0.01
R7536:Fbxl20 UTSW 11 98095383 nonsense probably null
X0067:Fbxl20 UTSW 11 98096978 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CATCAGTGCTCTTTACCCTGAG -3'
(R):5'- GGCAGTGAGTCAGTCAGTTC -3'

Sequencing Primer
(F):5'- GAGTCTCTTGATGCCAGCC -3'
(R):5'- GAGTCAGTCAGTTCTGATTTATAGTC -3'
Posted On2014-10-15