Incidental Mutation 'R2227:Hdac9'
ID239805
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Namehistone deacetylase 9
SynonymsHdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission 040228-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2227 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location34047580-34917095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34407802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 251 (V251I)
Ref Sequence ENSEMBL: ENSMUSP00000147903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]
Predicted Effect probably benign
Transcript: ENSMUST00000110819
AA Change: V251I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: V251I

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209667
Predicted Effect probably benign
Transcript: ENSMUST00000209750
AA Change: V254I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000209902
AA Change: V251I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000209990
Predicted Effect probably benign
Transcript: ENSMUST00000210724
AA Change: V251I

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000211107
AA Change: V223I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211752
AA Change: V275I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T A 14: 60,088,219 probably benign Het
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Agl A T 3: 116,788,312 V306D possibly damaging Het
Alpk2 T A 18: 65,378,076 T17S probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BB014433 C A 8: 15,041,717 A379S probably benign Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Ccl2 G T 11: 82,036,601 probably null Het
Cct2 T C 10: 117,053,017 R526G probably null Het
Cep55 T C 19: 38,062,634 M164T probably benign Het
Clec2d G A 6: 129,184,251 A104T probably benign Het
Cyp3a11 A G 5: 145,868,547 L220P possibly damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exoc2 T A 13: 30,864,884 I729L probably benign Het
Fbxl20 T C 11: 98,090,849 I338V probably benign Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm6614 T G 6: 141,992,361 E277D possibly damaging Het
Gucy2c G A 6: 136,702,760 T943I probably damaging Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17rb A T 14: 30,006,081 S56R probably benign Het
Knl1 A G 2: 119,072,000 D1394G probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt6b A G 15: 101,679,122 V179A probably damaging Het
Lpar5 A T 6: 125,081,135 probably null Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Myl1 T C 1: 66,944,815 K31E possibly damaging Het
Myt1l T A 12: 29,826,970 L207I unknown Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Rc3h1 T C 1: 160,963,542 I932T probably benign Het
Rubcnl G A 14: 75,042,392 R405Q probably benign Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn1r86 T C 7: 13,102,920 I10V probably benign Het
Xpot T C 10: 121,622,860 R20G probably damaging Het
Zfp735 T A 11: 73,711,396 L389I possibly damaging Het
Zfp735 T G 11: 73,711,397 L389* probably null Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34095934 missense unknown
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34390256 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4441:Hdac9 UTSW 12 34389376 missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34373907 missense probably benign
R5229:Hdac9 UTSW 12 34437164 missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34373883 missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34215029 missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
R7069:Hdac9 UTSW 12 34429549 missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34374140 critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34390240 missense possibly damaging 0.81
R7917:Hdac9 UTSW 12 34433210 missense probably benign 0.31
R7974:Hdac9 UTSW 12 34303220 missense possibly damaging 0.87
R7990:Hdac9 UTSW 12 34215453 missense probably benign 0.05
R8489:Hdac9 UTSW 12 34437181 missense probably damaging 1.00
R8683:Hdac9 UTSW 12 34390221 missense probably damaging 1.00
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34373987 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACGGCTGGCGAATACAGAG -3'
(R):5'- CTGGGAGAAGATTGGCATTGC -3'

Sequencing Primer
(F):5'- CTGGCGAATACAGAGCAAAGTTTAC -3'
(R):5'- ACACGGGAGTATTTGGC -3'
Posted On2014-10-15