Incidental Mutation 'R2227:Exoc2'
ID 239806
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission 040228-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R2227 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30864884 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 729 (I729L)
Ref Sequence ENSEMBL: ENSMUSP00000100010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: I729L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: I729L

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: I729L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: I729L

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T A 14: 60,088,219 probably benign Het
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Agl A T 3: 116,788,312 V306D possibly damaging Het
Alpk2 T A 18: 65,378,076 T17S probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BB014433 C A 8: 15,041,717 A379S probably benign Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Ccl2 G T 11: 82,036,601 probably null Het
Cct2 T C 10: 117,053,017 R526G probably null Het
Cep55 T C 19: 38,062,634 M164T probably benign Het
Clec2d G A 6: 129,184,251 A104T probably benign Het
Cyp3a11 A G 5: 145,868,547 L220P possibly damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Fbxl20 T C 11: 98,090,849 I338V probably benign Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm6614 T G 6: 141,992,361 E277D possibly damaging Het
Gucy2c G A 6: 136,702,760 T943I probably damaging Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17rb A T 14: 30,006,081 S56R probably benign Het
Knl1 A G 2: 119,072,000 D1394G probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt6b A G 15: 101,679,122 V179A probably damaging Het
Lpar5 A T 6: 125,081,135 probably null Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Myl1 T C 1: 66,944,815 K31E possibly damaging Het
Myt1l T A 12: 29,826,970 L207I unknown Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Rc3h1 T C 1: 160,963,542 I932T probably benign Het
Rubcnl G A 14: 75,042,392 R405Q probably benign Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn1r86 T C 7: 13,102,920 I10V probably benign Het
Xpot T C 10: 121,622,860 R20G probably damaging Het
Zfp735 T A 11: 73,711,396 L389I possibly damaging Het
Zfp735 T G 11: 73,711,397 L389* probably null Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCATTCTCAGATGGGTAGGGTG -3'
(R):5'- TGTGTGTTAATTTTAGGACACAGCC -3'

Sequencing Primer
(F):5'- CATTCTCAGATGGGTAGGGTGAAGAG -3'
(R):5'- TTTTAGGACACAGCCAAGAAAAC -3'
Posted On 2014-10-15