Incidental Mutation 'R0184:Pno1'
ID 23981
Institutional Source Beutler Lab
Gene Symbol Pno1
Ensembl Gene ENSMUSG00000020116
Gene Name partner of NOB1 homolog
Synonyms Imi3, 1810003N24Rik, expressed during mesenchymal induction 3, Emi3
MMRRC Submission 038449-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0184 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 17203198-17211568 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17211127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 69 (E69G)
Ref Sequence ENSEMBL: ENSMUSP00000020317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020317] [ENSMUST00000046955]
AlphaFold Q9CPS7
Predicted Effect probably benign
Transcript: ENSMUST00000020317
AA Change: E69G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020317
Gene: ENSMUSG00000020116
AA Change: E69G

DomainStartEndE-ValueType
KH 153 226 8.92e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046955
SMART Domains Protein: ENSMUSP00000040938
Gene: ENSMUSG00000078970

DomainStartEndE-ValueType
WD40 55 96 6.88e0 SMART
WD40 100 145 5.15e-2 SMART
Blast:WD40 149 196 8e-27 BLAST
WD40 199 240 2.54e2 SMART
WD40 246 288 2.06e0 SMART
WD40 310 350 7.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151431
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit eombryonic lethality between E3.5 and E6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 (GRCm38) V131F probably damaging Het
Adam28 T C 14: 68,637,373 (GRCm38) D285G probably benign Het
Akr1c13 A G 13: 4,194,056 (GRCm38) E36G probably damaging Het
Antxr2 A G 5: 97,980,030 (GRCm38) L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 (GRCm38) D46E unknown Het
Armc9 T C 1: 86,198,370 (GRCm38) L61P probably damaging Het
Bicc1 C A 10: 71,079,215 (GRCm38) R73L probably benign Het
Calm2 T C 17: 87,435,841 (GRCm38) N43S probably benign Het
Cct7 A G 6: 85,461,554 (GRCm38) D105G probably null Het
Cdk18 T C 1: 132,118,538 (GRCm38) N215D probably benign Het
Cep126 T C 9: 8,103,395 (GRCm38) T205A probably benign Het
Cfap57 A T 4: 118,599,012 (GRCm38) I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 (GRCm38) C152* probably null Het
Dab2ip G A 2: 35,718,791 (GRCm38) R579H probably damaging Het
Dnah8 T C 17: 30,683,683 (GRCm38) V905A probably benign Het
Eif4h C A 5: 134,625,375 (GRCm38) D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 (GRCm38) S372T probably benign Het
Fat2 T A 11: 55,296,288 (GRCm38) H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 (GRCm38) N443I probably benign Het
Git2 G A 5: 114,739,037 (GRCm38) T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 (GRCm38) Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 (GRCm38) Y152* probably null Het
Heatr5a T C 12: 51,909,969 (GRCm38) D1115G probably benign Het
Hipk2 T C 6: 38,718,931 (GRCm38) N726S possibly damaging Het
Hrg T C 16: 22,953,771 (GRCm38) probably null Het
Iars1 T G 13: 49,722,212 (GRCm38) S792A probably benign Het
Igf1r A G 7: 68,226,193 (GRCm38) N1301S possibly damaging Het
Il22 A T 10: 118,205,606 (GRCm38) I75F probably damaging Het
Ilkap T C 1: 91,376,305 (GRCm38) probably benign Het
Ints13 A T 6: 146,555,044 (GRCm38) Y435N probably benign Het
Ints8 A C 4: 11,218,637 (GRCm38) S797A probably benign Het
Itgad T A 7: 128,189,231 (GRCm38) D405E probably benign Het
Itgam A T 7: 128,086,058 (GRCm38) I448F probably damaging Het
Klk1 C T 7: 44,228,749 (GRCm38) T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 (GRCm38) M1V probably null Het
Mdga1 A G 17: 29,852,442 (GRCm38) Y128H probably damaging Het
Mtor G T 4: 148,464,971 (GRCm38) R604L probably benign Het
Or52p1 T C 7: 104,618,240 (GRCm38) V187A probably damaging Het
Or5d41 A T 2: 88,224,780 (GRCm38) L84* probably null Het
Pcdhb7 T A 18: 37,343,390 (GRCm38) D526E probably benign Het
Pip4k2a T C 2: 18,889,128 (GRCm38) D139G probably damaging Het
Pkp3 A C 7: 141,088,367 (GRCm38) N536T probably benign Het
Pla2g4c T A 7: 13,356,220 (GRCm38) S524T probably benign Het
Pold1 C T 7: 44,541,715 (GRCm38) V231M probably benign Het
Poli A G 18: 70,522,731 (GRCm38) S248P probably damaging Het
Ppox C T 1: 171,279,552 (GRCm38) S138N probably damaging Het
Psg20 T C 7: 18,685,976 (GRCm38) E6G probably null Het
Rbmx C T X: 57,391,566 (GRCm38) probably null Het
Rln1 T A 19: 29,331,936 (GRCm38) K148* probably null Het
Rnf213 C T 11: 119,414,521 (GRCm38) T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 (GRCm38) V904E probably null Het
Sf3b2 T A 19: 5,283,672 (GRCm38) I633F probably damaging Het
Sfswap T A 5: 129,507,189 (GRCm38) I189N probably damaging Het
Smarca2 T A 19: 26,692,249 (GRCm38) Y973* probably null Het
Spink5 G A 18: 44,003,198 (GRCm38) D559N probably benign Het
Spty2d1 C T 7: 46,997,574 (GRCm38) V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 (GRCm38) I221T probably damaging Het
Tcf20 T A 15: 82,852,300 (GRCm38) D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 (GRCm38) K45R probably benign Het
Tirap A G 9: 35,189,194 (GRCm38) S65P probably benign Het
Trim25 C T 11: 88,999,640 (GRCm38) P51L probably damaging Het
Trim61 T C 8: 65,014,417 (GRCm38) N64S probably benign Het
Twf1 T A 15: 94,581,067 (GRCm38) probably null Het
Ubr4 A C 4: 139,445,262 (GRCm38) T1692P probably damaging Het
Usp3 A G 9: 66,562,581 (GRCm38) M86T probably damaging Het
Utrn T C 10: 12,667,618 (GRCm38) D1762G probably benign Het
V1rd19 T A 7: 24,003,207 (GRCm38) F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 (GRCm38) S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 (GRCm38) W472* probably null Het
Vrk2 C A 11: 26,550,046 (GRCm38) A56S probably damaging Het
Yeats2 C T 16: 20,203,685 (GRCm38) P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 (GRCm38) D171N probably damaging Het
Zeb1 A T 18: 5,766,808 (GRCm38) I440F probably damaging Het
Zfp292 A G 4: 34,819,563 (GRCm38) I253T probably damaging Het
Other mutations in Pno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Pno1 APN 11 17,211,317 (GRCm38) missense probably benign 0.00
IGL01475:Pno1 APN 11 17,210,992 (GRCm38) missense probably damaging 1.00
IGL03166:Pno1 APN 11 17,204,513 (GRCm38) splice site probably null
R1302:Pno1 UTSW 11 17,204,545 (GRCm38) missense probably benign 0.42
R1978:Pno1 UTSW 11 17,204,519 (GRCm38) missense possibly damaging 0.57
R4345:Pno1 UTSW 11 17,209,095 (GRCm38) missense possibly damaging 0.73
R4586:Pno1 UTSW 11 17,211,438 (GRCm38) missense probably benign 0.00
R7027:Pno1 UTSW 11 17,208,880 (GRCm38) missense possibly damaging 0.63
R7890:Pno1 UTSW 11 17,211,443 (GRCm38) missense probably benign 0.00
R9376:Pno1 UTSW 11 17,208,791 (GRCm38) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTACGAAATGGCTACCCTCTTCC -3'
(R):5'- GCATATCCCAGGACAGCAATTCCG -3'

Sequencing Primer
(F):5'- GAAATGGCTACCCTCTTCCTTACC -3'
(R):5'- GGATCAggacgggacgg -3'
Posted On 2013-04-16