Incidental Mutation 'R2227:Krt6b'
ID239813
Institutional Source Beutler Lab
Gene Symbol Krt6b
Ensembl Gene ENSMUSG00000023041
Gene Namekeratin 6B
SynonymsKrt2-6b, mK6[b]
MMRRC Submission 040228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2227 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101676023-101680287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101679122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000023786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023786]
Predicted Effect probably damaging
Transcript: ENSMUST00000023786
AA Change: V179A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023786
Gene: ENSMUSG00000023041
AA Change: V179A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 1.3e-36 PFAM
Filament 151 464 2.79e-175 SMART
low complexity region 483 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198940
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T A 14: 60,088,219 probably benign Het
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Agl A T 3: 116,788,312 V306D possibly damaging Het
Alpk2 T A 18: 65,378,076 T17S probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BB014433 C A 8: 15,041,717 A379S probably benign Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Ccl2 G T 11: 82,036,601 probably null Het
Cct2 T C 10: 117,053,017 R526G probably null Het
Cep55 T C 19: 38,062,634 M164T probably benign Het
Clec2d G A 6: 129,184,251 A104T probably benign Het
Cyp3a11 A G 5: 145,868,547 L220P possibly damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exoc2 T A 13: 30,864,884 I729L probably benign Het
Fbxl20 T C 11: 98,090,849 I338V probably benign Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm6614 T G 6: 141,992,361 E277D possibly damaging Het
Gucy2c G A 6: 136,702,760 T943I probably damaging Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17rb A T 14: 30,006,081 S56R probably benign Het
Knl1 A G 2: 119,072,000 D1394G probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Lpar5 A T 6: 125,081,135 probably null Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Myl1 T C 1: 66,944,815 K31E possibly damaging Het
Myt1l T A 12: 29,826,970 L207I unknown Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Rc3h1 T C 1: 160,963,542 I932T probably benign Het
Rubcnl G A 14: 75,042,392 R405Q probably benign Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn1r86 T C 7: 13,102,920 I10V probably benign Het
Xpot T C 10: 121,622,860 R20G probably damaging Het
Zfp735 T A 11: 73,711,396 L389I possibly damaging Het
Zfp735 T G 11: 73,711,397 L389* probably null Het
Other mutations in Krt6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Krt6b APN 15 101679832 missense probably benign 0.22
IGL01653:Krt6b APN 15 101679114 missense probably damaging 1.00
IGL01900:Krt6b APN 15 101677546 missense possibly damaging 0.45
IGL03187:Krt6b APN 15 101679957 missense probably benign
R0511:Krt6b UTSW 15 101677607 splice site probably benign
R0788:Krt6b UTSW 15 101677519 missense probably damaging 0.96
R1370:Krt6b UTSW 15 101677552 missense probably damaging 0.96
R1481:Krt6b UTSW 15 101678374 missense probably benign 0.05
R2007:Krt6b UTSW 15 101678127 missense probably damaging 1.00
R2112:Krt6b UTSW 15 101678564 missense possibly damaging 0.48
R2166:Krt6b UTSW 15 101678615 critical splice acceptor site probably null
R2495:Krt6b UTSW 15 101678322 missense probably damaging 1.00
R2496:Krt6b UTSW 15 101679781 missense probably damaging 1.00
R4726:Krt6b UTSW 15 101678085 missense probably damaging 0.98
R4969:Krt6b UTSW 15 101680025 missense possibly damaging 0.71
R6301:Krt6b UTSW 15 101678951 missense probably damaging 1.00
R6646:Krt6b UTSW 15 101677214 missense probably damaging 0.98
R7232:Krt6b UTSW 15 101678142 missense probably damaging 1.00
R7406:Krt6b UTSW 15 101679078 missense probably benign 0.04
R7414:Krt6b UTSW 15 101679014 missense probably benign 0.05
R7849:Krt6b UTSW 15 101678574 missense probably damaging 1.00
R8110:Krt6b UTSW 15 101680142 missense probably damaging 0.96
R8348:Krt6b UTSW 15 101678020 missense probably damaging 1.00
R8448:Krt6b UTSW 15 101678020 missense probably damaging 1.00
R8736:Krt6b UTSW 15 101678612 missense probably damaging 1.00
Z1177:Krt6b UTSW 15 101678332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCTTGTTTAAATTTGGGC -3'
(R):5'- ACTGTTTCCCTCAGACCCAG -3'

Sequencing Primer
(F):5'- GGCTTCCATTTTTATAAAGTCCGGAG -3'
(R):5'- CAGGGTCAGGGTCTAACTACAC -3'
Posted On2014-10-15