Incidental Mutation 'R2228:Tanc1'
ID239827
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms1200003E16Rik
MMRRC Submission 040229-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2228 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location59612042-59846149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59724724 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 42 (L42S)
Ref Sequence ENSEMBL: ENSMUSP00000108187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
Predicted Effect probably benign
Transcript: ENSMUST00000037526
AA Change: L42S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: L42S

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112568
AA Change: L42S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: L42S

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127013
Predicted Effect probably benign
Transcript: ENSMUST00000139863
AA Change: L42S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: L42S

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,729,591 T242A probably benign Het
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Aldh3b2 C T 19: 3,981,133 P461S probably benign Het
Araf T C X: 20,851,673 F144L probably benign Het
Atp11b G T 3: 35,806,942 D193Y probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Bclaf1 T A 10: 20,339,878 probably benign Het
Cadps A G 14: 12,465,935 Y987H probably benign Het
Capn6 T G X: 143,804,789 T498P possibly damaging Het
Ccdc153 T A 9: 44,243,017 L47Q probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cep162 G T 9: 87,244,331 T176K probably benign Het
Cpsf2 A G 12: 101,989,829 D297G probably benign Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Eprs T A 1: 185,367,537 L18Q probably damaging Het
Fem1b G T 9: 62,796,738 C413* probably null Het
Flrt1 T A 19: 7,095,358 D608V probably damaging Het
Fstl5 C A 3: 76,482,352 N285K probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
H2afy C T 13: 56,084,262 G235S probably damaging Het
Hivep2 A G 10: 14,128,363 H235R probably damaging Het
Htr2c G C X: 147,194,190 W325C probably damaging Het
Htr2c G T X: 147,194,192 C326F probably damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Mcm8 T A 2: 132,820,121 I125K possibly damaging Het
Micall1 C T 15: 79,129,836 R644W probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo9a A G 9: 59,894,180 E1887G probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Neb T C 2: 52,232,995 R3734G probably benign Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Olfr1350 A T 7: 6,570,803 M271L probably benign Het
P2ry4 A G X: 100,593,947 L115P probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r26 T C 2: 28,453,786 F1143L possibly damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Ptafr T G 4: 132,579,380 I27R possibly damaging Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Reln A G 5: 21,987,078 F1455L possibly damaging Het
Rufy1 C T 11: 50,397,784 probably null Het
Samd9l T C 6: 3,376,910 H117R probably benign Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Sipa1l3 T A 7: 29,377,939 K803* probably null Het
Smim23 C A 11: 32,821,870 Q65H probably damaging Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Sppl2b G A 10: 80,865,617 V389M probably damaging Het
Srbd1 T C 17: 85,985,223 I973V probably damaging Het
Ssx2ip C T 3: 146,417,776 P10L probably damaging Het
Taf2 A C 15: 55,064,646 D120E possibly damaging Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Tro A T X: 150,655,481 M60K probably benign Het
Ttc38 G A 15: 85,844,503 V219I probably benign Het
U2af2 T C 7: 5,075,673 I417T probably damaging Het
Ube2r2 C T 4: 41,174,044 H61Y probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r113 C T 7: 20,787,907 S208F probably damaging Het
Wdr35 A G 12: 8,974,955 K16E possibly damaging Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc4 A C 5: 143,320,407 W189G probably damaging Het
Zfp512 A T 5: 31,465,575 K73N probably damaging Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59790841 missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59793176 missense probably benign 0.00
IGL00688:Tanc1 APN 2 59815391 missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59806301 missense probably benign 0.15
IGL01576:Tanc1 APN 2 59797735 missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59785473 missense probably benign
IGL02016:Tanc1 APN 2 59843590 missense probably benign 0.00
IGL02373:Tanc1 APN 2 59796028 critical splice donor site probably null
IGL02539:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59724654 splice site probably benign
IGL02626:Tanc1 APN 2 59799872 missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59799986 missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59793087 splice site probably benign
Oreja UTSW 2 59791804 synonymous silent
R0178:Tanc1 UTSW 2 59835447 nonsense probably null
R0347:Tanc1 UTSW 2 59842991 missense probably benign
R0570:Tanc1 UTSW 2 59796038 splice site probably benign
R0660:Tanc1 UTSW 2 59843884 nonsense probably null
R0664:Tanc1 UTSW 2 59843884 nonsense probably null
R0898:Tanc1 UTSW 2 59790788 missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59843491 missense probably benign
R1575:Tanc1 UTSW 2 59791651 missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59797694 missense possibly damaging 0.80
R1616:Tanc1 UTSW 2 59785387 missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59843021 missense probably benign 0.02
R1727:Tanc1 UTSW 2 59790809 missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59800097 missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59791679 missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59724751 missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59791812 missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59843833 missense possibly damaging 0.72
R2267:Tanc1 UTSW 2 59837219 critical splice donor site probably null
R4191:Tanc1 UTSW 2 59839013 missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59841996 splice site probably null
R4632:Tanc1 UTSW 2 59795835 missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59699422 missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59799943 missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59795834 missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59834707 splice site probably null
R5672:Tanc1 UTSW 2 59772353 missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59795997 missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59758530 missense probably benign
R5778:Tanc1 UTSW 2 59699347 critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59807582 missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59785341 missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59799904 missense probably benign 0.00
R5912:Tanc1 UTSW 2 59791686 missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59837220 critical splice donor site probably null
R6057:Tanc1 UTSW 2 59817493 missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59833222 nonsense probably null
R6179:Tanc1 UTSW 2 59842976 missense probably benign 0.42
R6185:Tanc1 UTSW 2 59791585 splice site probably null
R6192:Tanc1 UTSW 2 59838961 splice site probably null
R6196:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59842031 missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59843510 missense probably benign 0.22
R6415:Tanc1 UTSW 2 59837114 missense probably benign 0.02
R6480:Tanc1 UTSW 2 59807642 missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59795954 missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59791806 missense probably benign 0.00
R7006:Tanc1 UTSW 2 59795844 missense probably damaging 1.00
R7133:Tanc1 UTSW 2 59797609 missense probably benign 0.16
R7381:Tanc1 UTSW 2 59785326 missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59806344 missense probably benign 0.02
RF028:Tanc1 UTSW 2 59843269 small deletion probably benign
RF049:Tanc1 UTSW 2 59843269 small deletion probably benign
X0063:Tanc1 UTSW 2 59843980 nonsense probably null
X0064:Tanc1 UTSW 2 59844112 missense probably damaging 1.00
Z1176:Tanc1 UTSW 2 59772529 missense possibly damaging 0.93
Z1177:Tanc1 UTSW 2 59790887 missense probably benign
Z1177:Tanc1 UTSW 2 59791830 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGCTTGAGTTCCCCTGCAG -3'
(R):5'- CTCCCAGAAGATTTCTTACATGTACTC -3'

Sequencing Primer
(F):5'- CTGCAGGCAGTGGAGTTC -3'
(R):5'- CATGATATAGATCATATGTGATGC -3'
Posted On2014-10-15