Incidental Mutation 'R2228:Atp11b'
ID239831
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene NameATPase, class VI, type 11B
Synonyms1110019I14Rik
MMRRC Submission 040229-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R2228 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location35754106-35856276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35806942 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 193 (D193Y)
Ref Sequence ENSEMBL: ENSMUSP00000142676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]
Predicted Effect probably damaging
Transcript: ENSMUST00000029257
AA Change: D393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: D393Y

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196965
Predicted Effect probably damaging
Transcript: ENSMUST00000198599
AA Change: D193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: D193Y

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000199892
AA Change: D250Y
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200445
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,729,591 T242A probably benign Het
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Aldh3b2 C T 19: 3,981,133 P461S probably benign Het
Araf T C X: 20,851,673 F144L probably benign Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Bclaf1 T A 10: 20,339,878 probably benign Het
Cadps A G 14: 12,465,935 Y987H probably benign Het
Capn6 T G X: 143,804,789 T498P possibly damaging Het
Ccdc153 T A 9: 44,243,017 L47Q probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cep162 G T 9: 87,244,331 T176K probably benign Het
Cpsf2 A G 12: 101,989,829 D297G probably benign Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Eprs T A 1: 185,367,537 L18Q probably damaging Het
Fem1b G T 9: 62,796,738 C413* probably null Het
Flrt1 T A 19: 7,095,358 D608V probably damaging Het
Fstl5 C A 3: 76,482,352 N285K probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
H2afy C T 13: 56,084,262 G235S probably damaging Het
Hivep2 A G 10: 14,128,363 H235R probably damaging Het
Htr2c G C X: 147,194,190 W325C probably damaging Het
Htr2c G T X: 147,194,192 C326F probably damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Mcm8 T A 2: 132,820,121 I125K possibly damaging Het
Micall1 C T 15: 79,129,836 R644W probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo9a A G 9: 59,894,180 E1887G probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Neb T C 2: 52,232,995 R3734G probably benign Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Olfr1350 A T 7: 6,570,803 M271L probably benign Het
P2ry4 A G X: 100,593,947 L115P probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r26 T C 2: 28,453,786 F1143L possibly damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Ptafr T G 4: 132,579,380 I27R possibly damaging Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Reln A G 5: 21,987,078 F1455L possibly damaging Het
Rufy1 C T 11: 50,397,784 probably null Het
Samd9l T C 6: 3,376,910 H117R probably benign Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Sipa1l3 T A 7: 29,377,939 K803* probably null Het
Smim23 C A 11: 32,821,870 Q65H probably damaging Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Sppl2b G A 10: 80,865,617 V389M probably damaging Het
Srbd1 T C 17: 85,985,223 I973V probably damaging Het
Ssx2ip C T 3: 146,417,776 P10L probably damaging Het
Taf2 A C 15: 55,064,646 D120E possibly damaging Het
Tanc1 T C 2: 59,724,724 L42S probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Tro A T X: 150,655,481 M60K probably benign Het
Ttc38 G A 15: 85,844,503 V219I probably benign Het
U2af2 T C 7: 5,075,673 I417T probably damaging Het
Ube2r2 C T 4: 41,174,044 H61Y probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r113 C T 7: 20,787,907 S208F probably damaging Het
Wdr35 A G 12: 8,974,955 K16E possibly damaging Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc4 A C 5: 143,320,407 W189G probably damaging Het
Zfp512 A T 5: 31,465,575 K73N probably damaging Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35809376 unclassified probably null
IGL00722:Atp11b APN 3 35819935 missense probably damaging 1.00
IGL00725:Atp11b APN 3 35827073 missense probably damaging 0.97
IGL01514:Atp11b APN 3 35836981 missense probably damaging 1.00
IGL01532:Atp11b APN 3 35849502 nonsense probably null
IGL01789:Atp11b APN 3 35789592 missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35831463 missense probably damaging 1.00
IGL02009:Atp11b APN 3 35814152 missense probably benign 0.07
IGL02049:Atp11b APN 3 35800493 missense probably damaging 0.99
IGL02952:Atp11b APN 3 35828695 missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35826991 missense probably benign 0.00
R0044:Atp11b UTSW 3 35812252 missense probably damaging 0.99
R0254:Atp11b UTSW 3 35812110 missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35837014 missense probably damaging 1.00
R0541:Atp11b UTSW 3 35806944 missense probably damaging 0.99
R0653:Atp11b UTSW 3 35839194 missense probably damaging 0.99
R0790:Atp11b UTSW 3 35832923 missense probably damaging 1.00
R1083:Atp11b UTSW 3 35778013 splice site probably benign
R1371:Atp11b UTSW 3 35806769 missense probably damaging 0.97
R1458:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R1875:Atp11b UTSW 3 35839147 missense probably damaging 1.00
R1921:Atp11b UTSW 3 35834325 missense probably damaging 1.00
R2008:Atp11b UTSW 3 35855122 missense probably damaging 0.97
R2065:Atp11b UTSW 3 35839074 missense probably damaging 1.00
R2112:Atp11b UTSW 3 35837528 missense probably damaging 1.00
R2270:Atp11b UTSW 3 35810134 unclassified probably null
R2273:Atp11b UTSW 3 35828613 missense probably benign 0.04
R2439:Atp11b UTSW 3 35814084 missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35855145 missense probably damaging 0.99
R4181:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R4181:Atp11b UTSW 3 35800565 missense probably benign 0.19
R4714:Atp11b UTSW 3 35834394 missense probably benign 0.02
R4923:Atp11b UTSW 3 35835379 critical splice donor site probably null
R4937:Atp11b UTSW 3 35807008 unclassified probably null
R5013:Atp11b UTSW 3 35834383 missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35809361 missense probably benign 0.41
R5171:Atp11b UTSW 3 35832937 missense probably damaging 1.00
R5200:Atp11b UTSW 3 35837007 missense probably benign 0.21
R5465:Atp11b UTSW 3 35810184 missense probably benign 0.00
R5651:Atp11b UTSW 3 35855140 missense probably damaging 1.00
R5689:Atp11b UTSW 3 35834352 missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35837516 missense probably benign 0.12
R5807:Atp11b UTSW 3 35812279 missense probably damaging 1.00
R5888:Atp11b UTSW 3 35837547 missense probably benign 0.15
R6059:Atp11b UTSW 3 35814177 missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35806901 missense probably damaging 1.00
R6359:Atp11b UTSW 3 35778061 missense probably benign 0.04
R6367:Atp11b UTSW 3 35784537 missense probably damaging 1.00
R6577:Atp11b UTSW 3 35839162 missense probably damaging 0.99
R6818:Atp11b UTSW 3 35814180 missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35841036 missense probably benign
R7178:Atp11b UTSW 3 35819950 missense probably benign 0.34
R7614:Atp11b UTSW 3 35810110 splice site probably null
R7729:Atp11b UTSW 3 35778107 missense probably damaging 0.97
R7910:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
R7991:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
R8085:Atp11b UTSW 3 35841036 missense probably benign
R8095:Atp11b UTSW 3 35834416 missense probably damaging 1.00
Z1088:Atp11b UTSW 3 35812213 missense probably damaging 1.00
Z1177:Atp11b UTSW 3 35806854 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTTGATGCTAGGTTACCTCAGG -3'
(R):5'- GTTAAGACCTAAAGTGGAAATGGTC -3'

Sequencing Primer
(F):5'- ATGCTAGGTTACCTCAGGATATGG -3'
(R):5'- GTGGAAATGGTCAGGATATAAAGTG -3'
Posted On2014-10-15