Incidental Mutation 'R2228:Ssx2ip'
ID239833
Institutional Source Beutler Lab
Gene Symbol Ssx2ip
Ensembl Gene ENSMUSG00000036825
Gene Namesynovial sarcoma, X 2 interacting protein
SynonymsAdip
MMRRC Submission 040229-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2228 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146404642-146440144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 146417776 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 10 (P10L)
Ref Sequence ENSEMBL: ENSMUSP00000117501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039021] [ENSMUST00000106149] [ENSMUST00000106151] [ENSMUST00000106153] [ENSMUST00000129978] [ENSMUST00000149262]
Predicted Effect probably benign
Transcript: ENSMUST00000039021
AA Change: P10L

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045663
Gene: ENSMUSG00000036825
AA Change: P10L

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106149
AA Change: P10L

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101755
Gene: ENSMUSG00000036825
AA Change: P10L

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106151
AA Change: P10L

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101757
Gene: ENSMUSG00000036825
AA Change: P10L

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106153
AA Change: P10L

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101759
Gene: ENSMUSG00000036825
AA Change: P10L

DomainStartEndE-ValueType
Pfam:ADIP 63 214 1.2e-47 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 410 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
Blast:LPD_N 440 481 3e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000129978
AA Change: P10L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117501
Gene: ENSMUSG00000036825
AA Change: P10L

DomainStartEndE-ValueType
Pfam:ADIP 63 134 5.9e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149262
AA Change: P10L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the cancer-testis antigen Synovial Sarcoma X breakpoint 2 protein. The encoded protein may regulate the activity of Synovial Sarcoma X breakpoint 2 protein in malignant cells. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,729,591 T242A probably benign Het
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Aldh3b2 C T 19: 3,981,133 P461S probably benign Het
Araf T C X: 20,851,673 F144L probably benign Het
Atp11b G T 3: 35,806,942 D193Y probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Bclaf1 T A 10: 20,339,878 probably benign Het
Cadps A G 14: 12,465,935 Y987H probably benign Het
Capn6 T G X: 143,804,789 T498P possibly damaging Het
Ccdc153 T A 9: 44,243,017 L47Q probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cep162 G T 9: 87,244,331 T176K probably benign Het
Cpsf2 A G 12: 101,989,829 D297G probably benign Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Eprs T A 1: 185,367,537 L18Q probably damaging Het
Fem1b G T 9: 62,796,738 C413* probably null Het
Flrt1 T A 19: 7,095,358 D608V probably damaging Het
Fstl5 C A 3: 76,482,352 N285K probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
H2afy C T 13: 56,084,262 G235S probably damaging Het
Hivep2 A G 10: 14,128,363 H235R probably damaging Het
Htr2c G C X: 147,194,190 W325C probably damaging Het
Htr2c G T X: 147,194,192 C326F probably damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Mcm8 T A 2: 132,820,121 I125K possibly damaging Het
Micall1 C T 15: 79,129,836 R644W probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo9a A G 9: 59,894,180 E1887G probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Neb T C 2: 52,232,995 R3734G probably benign Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Olfr1350 A T 7: 6,570,803 M271L probably benign Het
P2ry4 A G X: 100,593,947 L115P probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r26 T C 2: 28,453,786 F1143L possibly damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Ptafr T G 4: 132,579,380 I27R possibly damaging Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Reln A G 5: 21,987,078 F1455L possibly damaging Het
Rufy1 C T 11: 50,397,784 probably null Het
Samd9l T C 6: 3,376,910 H117R probably benign Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Sipa1l3 T A 7: 29,377,939 K803* probably null Het
Smim23 C A 11: 32,821,870 Q65H probably damaging Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Sppl2b G A 10: 80,865,617 V389M probably damaging Het
Srbd1 T C 17: 85,985,223 I973V probably damaging Het
Taf2 A C 15: 55,064,646 D120E possibly damaging Het
Tanc1 T C 2: 59,724,724 L42S probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Tro A T X: 150,655,481 M60K probably benign Het
Ttc38 G A 15: 85,844,503 V219I probably benign Het
U2af2 T C 7: 5,075,673 I417T probably damaging Het
Ube2r2 C T 4: 41,174,044 H61Y probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r113 C T 7: 20,787,907 S208F probably damaging Het
Wdr35 A G 12: 8,974,955 K16E possibly damaging Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc4 A C 5: 143,320,407 W189G probably damaging Het
Zfp512 A T 5: 31,465,575 K73N probably damaging Het
Other mutations in Ssx2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Ssx2ip APN 3 146436552 missense probably damaging 1.00
IGL01140:Ssx2ip APN 3 146427843 missense probably benign 0.02
IGL01810:Ssx2ip APN 3 146428010 missense probably benign 0.00
R0432:Ssx2ip UTSW 3 146426429 missense probably damaging 1.00
R0903:Ssx2ip UTSW 3 146430977 missense probably benign
R3151:Ssx2ip UTSW 3 146418383 missense probably benign 0.00
R4348:Ssx2ip UTSW 3 146432490 missense probably benign 0.01
R4446:Ssx2ip UTSW 3 146426431 missense probably benign 0.31
R4796:Ssx2ip UTSW 3 146418359 missense probably benign 0.02
R5054:Ssx2ip UTSW 3 146430917 splice site probably benign
R5338:Ssx2ip UTSW 3 146436541 critical splice acceptor site probably null
R5520:Ssx2ip UTSW 3 146437311 missense probably benign 0.03
R5898:Ssx2ip UTSW 3 146427831 missense possibly damaging 0.94
R6367:Ssx2ip UTSW 3 146419166 missense probably benign 0.16
R6777:Ssx2ip UTSW 3 146438721 missense possibly damaging 0.88
R7082:Ssx2ip UTSW 3 146430948 missense probably benign 0.01
R7239:Ssx2ip UTSW 3 146428016 missense probably damaging 1.00
R7249:Ssx2ip UTSW 3 146426438 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGCTTTCACTGGGCTTCATC -3'
(R):5'- ATAATCTCTTGCCCACCGTAG -3'

Sequencing Primer
(F):5'- CACTGGGCTTCATCTTTTAAGTTTG -3'
(R):5'- TGCCCACCGTAGCGCAG -3'
Posted On2014-10-15