Incidental Mutation 'R2228:Nbn'
ID239834
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Namenibrin
SynonymsNbs1
MMRRC Submission 040229-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2228 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location15957925-15992589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15970904 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 296 (T296A)
Ref Sequence ENSEMBL: ENSMUSP00000029879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
Predicted Effect probably benign
Transcript: ENSMUST00000029879
AA Change: T296A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: T296A

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118701
Predicted Effect probably benign
Transcript: ENSMUST00000149069
AA Change: T296A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: T296A

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,729,591 T242A probably benign Het
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Aldh3b2 C T 19: 3,981,133 P461S probably benign Het
Araf T C X: 20,851,673 F144L probably benign Het
Atp11b G T 3: 35,806,942 D193Y probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Bclaf1 T A 10: 20,339,878 probably benign Het
Cadps A G 14: 12,465,935 Y987H probably benign Het
Capn6 T G X: 143,804,789 T498P possibly damaging Het
Ccdc153 T A 9: 44,243,017 L47Q probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cep162 G T 9: 87,244,331 T176K probably benign Het
Cpsf2 A G 12: 101,989,829 D297G probably benign Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Eprs T A 1: 185,367,537 L18Q probably damaging Het
Fem1b G T 9: 62,796,738 C413* probably null Het
Flrt1 T A 19: 7,095,358 D608V probably damaging Het
Fstl5 C A 3: 76,482,352 N285K probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
H2afy C T 13: 56,084,262 G235S probably damaging Het
Hivep2 A G 10: 14,128,363 H235R probably damaging Het
Htr2c G C X: 147,194,190 W325C probably damaging Het
Htr2c G T X: 147,194,192 C326F probably damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Mcm8 T A 2: 132,820,121 I125K possibly damaging Het
Micall1 C T 15: 79,129,836 R644W probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo9a A G 9: 59,894,180 E1887G probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Neb T C 2: 52,232,995 R3734G probably benign Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Olfr1350 A T 7: 6,570,803 M271L probably benign Het
P2ry4 A G X: 100,593,947 L115P probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r26 T C 2: 28,453,786 F1143L possibly damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Ptafr T G 4: 132,579,380 I27R possibly damaging Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Reln A G 5: 21,987,078 F1455L possibly damaging Het
Rufy1 C T 11: 50,397,784 probably null Het
Samd9l T C 6: 3,376,910 H117R probably benign Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Sipa1l3 T A 7: 29,377,939 K803* probably null Het
Smim23 C A 11: 32,821,870 Q65H probably damaging Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Sppl2b G A 10: 80,865,617 V389M probably damaging Het
Srbd1 T C 17: 85,985,223 I973V probably damaging Het
Ssx2ip C T 3: 146,417,776 P10L probably damaging Het
Taf2 A C 15: 55,064,646 D120E possibly damaging Het
Tanc1 T C 2: 59,724,724 L42S probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Tro A T X: 150,655,481 M60K probably benign Het
Ttc38 G A 15: 85,844,503 V219I probably benign Het
U2af2 T C 7: 5,075,673 I417T probably damaging Het
Ube2r2 C T 4: 41,174,044 H61Y probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r113 C T 7: 20,787,907 S208F probably damaging Het
Wdr35 A G 12: 8,974,955 K16E possibly damaging Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc4 A C 5: 143,320,407 W189G probably damaging Het
Zfp512 A T 5: 31,465,575 K73N probably damaging Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R4756:Nbn UTSW 4 15981470 missense probably benign 0.00
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7159:Nbn UTSW 4 15983677 splice site probably null
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
R7597:Nbn UTSW 4 15963911 missense probably damaging 1.00
R7937:Nbn UTSW 4 15958080 missense probably damaging 0.99
R8110:Nbn UTSW 4 15981588 missense probably benign 0.02
R8317:Nbn UTSW 4 15970893 missense probably damaging 0.96
R8327:Nbn UTSW 4 15981470 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAACTCAGCTCGGCAGTTG -3'
(R):5'- AGTCATGAAGGGCAAGCTTTTC -3'

Sequencing Primer
(F):5'- CAGCTCGGCAGTTGCTTTCG -3'
(R):5'- TCTGTGAATTGCAGGACAACC -3'
Posted On2014-10-15