Incidental Mutation 'R2228:Olfr1350'
ID239849
Institutional Source Beutler Lab
Gene Symbol Olfr1350
Ensembl Gene ENSMUSG00000056696
Gene Nameolfactory receptor 1350
SynonymsGA_x6K02T2QGBW-3300391-3301317, MOR222-3
MMRRC Submission 040229-MU
Accession Numbers

Genbank: NM_146389.1

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2228 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6564841-6571401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6570803 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 271 (M271L)
Ref Sequence ENSEMBL: ENSMUSP00000151318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070985] [ENSMUST00000207221] [ENSMUST00000219278]
Predicted Effect probably benign
Transcript: ENSMUST00000070985
AA Change: M271L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069927
Gene: ENSMUSG00000056696
AA Change: M271L

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-50 PFAM
Pfam:7tm_1 39 288 8.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207221
AA Change: M271L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219278
AA Change: M271L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,729,591 T242A probably benign Het
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Aldh3b2 C T 19: 3,981,133 P461S probably benign Het
Araf T C X: 20,851,673 F144L probably benign Het
Atp11b G T 3: 35,806,942 D193Y probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Bclaf1 T A 10: 20,339,878 probably benign Het
Cadps A G 14: 12,465,935 Y987H probably benign Het
Capn6 T G X: 143,804,789 T498P possibly damaging Het
Ccdc153 T A 9: 44,243,017 L47Q probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cep162 G T 9: 87,244,331 T176K probably benign Het
Cpsf2 A G 12: 101,989,829 D297G probably benign Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Eprs T A 1: 185,367,537 L18Q probably damaging Het
Fem1b G T 9: 62,796,738 C413* probably null Het
Flrt1 T A 19: 7,095,358 D608V probably damaging Het
Fstl5 C A 3: 76,482,352 N285K probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
H2afy C T 13: 56,084,262 G235S probably damaging Het
Hivep2 A G 10: 14,128,363 H235R probably damaging Het
Htr2c G C X: 147,194,190 W325C probably damaging Het
Htr2c G T X: 147,194,192 C326F probably damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Mcm8 T A 2: 132,820,121 I125K possibly damaging Het
Micall1 C T 15: 79,129,836 R644W probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo9a A G 9: 59,894,180 E1887G probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Neb T C 2: 52,232,995 R3734G probably benign Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
P2ry4 A G X: 100,593,947 L115P probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r26 T C 2: 28,453,786 F1143L possibly damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Ptafr T G 4: 132,579,380 I27R possibly damaging Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Reln A G 5: 21,987,078 F1455L possibly damaging Het
Rufy1 C T 11: 50,397,784 probably null Het
Samd9l T C 6: 3,376,910 H117R probably benign Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Sipa1l3 T A 7: 29,377,939 K803* probably null Het
Smim23 C A 11: 32,821,870 Q65H probably damaging Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Sppl2b G A 10: 80,865,617 V389M probably damaging Het
Srbd1 T C 17: 85,985,223 I973V probably damaging Het
Ssx2ip C T 3: 146,417,776 P10L probably damaging Het
Taf2 A C 15: 55,064,646 D120E possibly damaging Het
Tanc1 T C 2: 59,724,724 L42S probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Tro A T X: 150,655,481 M60K probably benign Het
Ttc38 G A 15: 85,844,503 V219I probably benign Het
U2af2 T C 7: 5,075,673 I417T probably damaging Het
Ube2r2 C T 4: 41,174,044 H61Y probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r113 C T 7: 20,787,907 S208F probably damaging Het
Wdr35 A G 12: 8,974,955 K16E possibly damaging Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc4 A C 5: 143,320,407 W189G probably damaging Het
Zfp512 A T 5: 31,465,575 K73N probably damaging Het
Other mutations in Olfr1350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Olfr1350 APN 7 6570668 missense possibly damaging 0.88
IGL01387:Olfr1350 APN 7 6570855 missense probably damaging 1.00
IGL01457:Olfr1350 APN 7 6570212 missense probably benign 0.12
IGL01568:Olfr1350 APN 7 6570570 missense possibly damaging 0.91
I2288:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
I2289:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
R0454:Olfr1350 UTSW 7 6570360 missense probably damaging 1.00
R0558:Olfr1350 UTSW 7 6570653 missense possibly damaging 0.77
R1103:Olfr1350 UTSW 7 6570112 missense probably damaging 1.00
R1352:Olfr1350 UTSW 7 6570783 missense probably benign 0.11
R1503:Olfr1350 UTSW 7 6570471 missense probably damaging 1.00
R1630:Olfr1350 UTSW 7 6570674 missense probably damaging 1.00
R1981:Olfr1350 UTSW 7 6570558 missense probably benign 0.01
R2258:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2259:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2260:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R4075:Olfr1350 UTSW 7 6570143 missense probably benign 0.00
R4750:Olfr1350 UTSW 7 6570851 missense probably benign 0.34
R4917:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R4918:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R5571:Olfr1350 UTSW 7 6570825 missense possibly damaging 0.95
R5915:Olfr1350 UTSW 7 6570173 missense probably benign 0.31
R6969:Olfr1350 UTSW 7 6570321 missense probably damaging 1.00
R7061:Olfr1350 UTSW 7 6570783 missense probably damaging 1.00
R7286:Olfr1350 UTSW 7 6570716 missense probably damaging 1.00
R7510:Olfr1350 UTSW 7 6569961 start gained probably benign
V1662:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
Z1176:Olfr1350 UTSW 7 6570048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGAGGCTGCAGGTTTTATAG -3'
(R):5'- CTTCAGCATGGTTTCAAGAGGG -3'

Sequencing Primer
(F):5'- GTCATCATGACTTGCTTTGCC -3'
(R):5'- GAAAGTAAGCTGGTTTCTGGAACTTC -3'
Posted On2014-10-15