Incidental Mutation 'R2234:BC035947'
ID239896
Institutional Source Beutler Lab
Gene Symbol BC035947
Ensembl Gene ENSMUSG00000090486
Gene NamecDNA sequence BC035947
Synonyms
MMRRC Submission 040235-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2234 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78497026-78512158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78497962 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 644 (D644E)
Ref Sequence ENSEMBL: ENSMUSP00000132488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170511]
Predicted Effect probably damaging
Transcript: ENSMUST00000170511
AA Change: D644E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132488
Gene: ENSMUSG00000090486
AA Change: D644E

DomainStartEndE-ValueType
PDB:2M9U|A 43 87 3e-13 PDB
Pfam:TLV_coat 109 691 3.8e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190853
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Akap8l C T 17: 32,338,803 G37R probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Cd81 T A 7: 143,066,319 N71K probably benign Het
Cemip G T 7: 83,998,562 D103E probably benign Het
Chfr A G 5: 110,170,863 K580E probably damaging Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cpb1 A T 3: 20,275,465 D32E probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
Eml5 A C 12: 98,841,581 D984E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hspa2 A G 12: 76,404,645 T38A possibly damaging Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kalrn C A 16: 34,176,262 probably null Het
Kmt2d T C 15: 98,865,248 D240G probably damaging Het
Lrrc56 T A 7: 141,198,294 D66E probably damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1089 A G 2: 86,733,577 F12L possibly damaging Het
Olfr1219 A G 2: 89,074,248 L281P probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr710 C A 7: 106,944,620 C127F probably damaging Het
Olfr832 A T 9: 18,944,816 H56L probably damaging Het
Pax8 A G 2: 24,443,102 I77T probably damaging Het
Paxbp1 T C 16: 91,034,934 I355M probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Plec A T 15: 76,176,947 I2952N probably damaging Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Ssc5d A G 7: 4,943,850 T1068A probably benign Het
Stambp A G 6: 83,551,978 S362P probably damaging Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tnk1 C T 11: 69,855,191 probably null Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xpnpep1 T G 19: 53,013,461 D118A probably damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Other mutations in BC035947
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1853:BC035947 UTSW 1 78499016 missense possibly damaging 0.95
R2079:BC035947 UTSW 1 78511924 utr 5 prime probably benign
R2235:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R3840:BC035947 UTSW 1 78497845 missense probably benign 0.00
R3841:BC035947 UTSW 1 78497845 missense probably benign 0.00
R4804:BC035947 UTSW 1 78497876 missense probably damaging 1.00
R4909:BC035947 UTSW 1 78498029 missense probably damaging 0.99
R5139:BC035947 UTSW 1 78499247 missense possibly damaging 0.60
R5302:BC035947 UTSW 1 78511962 start codon destroyed probably null 0.00
R5669:BC035947 UTSW 1 78497913 missense probably damaging 0.98
R5686:BC035947 UTSW 1 78497930 missense probably benign 0.03
R5868:BC035947 UTSW 1 78498323 missense probably damaging 1.00
R5988:BC035947 UTSW 1 78499206 nonsense probably null
R6787:BC035947 UTSW 1 78498890 missense possibly damaging 0.64
R6854:BC035947 UTSW 1 78498488 missense probably damaging 1.00
R7079:BC035947 UTSW 1 78497915 missense probably damaging 1.00
R7168:BC035947 UTSW 1 78499593 missense probably benign 0.04
R7387:BC035947 UTSW 1 78498461 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAAAATAAAGATGTCGTCCACAGT -3'
(R):5'- ATTACCTTGTGCCGTCTCCA -3'

Sequencing Primer
(F):5'- TAAAGATGTCGTCCACAGTGACCG -3'
(R):5'- CCCCCTGTGTATCAACTAAGG -3'
Posted On2014-10-15