Incidental Mutation 'R2234:Acbd6'
ID239899
Institutional Source Beutler Lab
Gene Symbol Acbd6
Ensembl Gene ENSMUSG00000033701
Gene Nameacyl-Coenzyme A binding domain containing 6
Synonyms0610010G04Rik, 2610100E10Rik
MMRRC Submission 040235-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2234 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155558120-155691330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155558708 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 24 (D24G)
Ref Sequence ENSEMBL: ENSMUSP00000095136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035560] [ENSMUST00000080138] [ENSMUST00000097529]
Predicted Effect probably damaging
Transcript: ENSMUST00000035560
AA Change: D24G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049124
Gene: ENSMUSG00000033701
AA Change: D24G

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:ACBP 43 123 1.5e-26 PFAM
low complexity region 130 148 N/A INTRINSIC
ANK 157 187 2.43e3 SMART
ANK 191 220 8.65e-5 SMART
ANK 224 253 8.19e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080138
AA Change: D24G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079035
Gene: ENSMUSG00000033701
AA Change: D24G

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:ACBP 42 126 1.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097529
AA Change: D24G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095136
Gene: ENSMUSG00000033701
AA Change: D24G

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:ACBP 42 126 1.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194476
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Akap8l C T 17: 32,338,803 G37R probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Cd81 T A 7: 143,066,319 N71K probably benign Het
Cemip G T 7: 83,998,562 D103E probably benign Het
Chfr A G 5: 110,170,863 K580E probably damaging Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cpb1 A T 3: 20,275,465 D32E probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
Eml5 A C 12: 98,841,581 D984E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hspa2 A G 12: 76,404,645 T38A possibly damaging Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kalrn C A 16: 34,176,262 probably null Het
Kmt2d T C 15: 98,865,248 D240G probably damaging Het
Lrrc56 T A 7: 141,198,294 D66E probably damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1089 A G 2: 86,733,577 F12L possibly damaging Het
Olfr1219 A G 2: 89,074,248 L281P probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr710 C A 7: 106,944,620 C127F probably damaging Het
Olfr832 A T 9: 18,944,816 H56L probably damaging Het
Pax8 A G 2: 24,443,102 I77T probably damaging Het
Paxbp1 T C 16: 91,034,934 I355M probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Plec A T 15: 76,176,947 I2952N probably damaging Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Ssc5d A G 7: 4,943,850 T1068A probably benign Het
Stambp A G 6: 83,551,978 S362P probably damaging Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tnk1 C T 11: 69,855,191 probably null Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xpnpep1 T G 19: 53,013,461 D118A probably damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Other mutations in Acbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1897:Acbd6 UTSW 1 155558818 missense probably damaging 0.96
R2190:Acbd6 UTSW 1 155624906 missense probably damaging 1.00
R2235:Acbd6 UTSW 1 155558708 missense probably damaging 1.00
R3730:Acbd6 UTSW 1 155558725 missense probably benign 0.24
R3731:Acbd6 UTSW 1 155558725 missense probably benign 0.24
R3888:Acbd6 UTSW 1 155624897 missense probably damaging 1.00
R4349:Acbd6 UTSW 1 155687081 missense probably benign
R4905:Acbd6 UTSW 1 155624923 missense probably benign 0.03
R4983:Acbd6 UTSW 1 155601529 missense probably benign 0.00
R5285:Acbd6 UTSW 1 155558725 missense probably benign 0.24
R5297:Acbd6 UTSW 1 155587458 missense probably benign 0.01
R5955:Acbd6 UTSW 1 155587459 missense probably benign 0.01
R7472:Acbd6 UTSW 1 155587467 nonsense probably null
R7719:Acbd6 UTSW 1 155687012 missense probably damaging 0.99
R7911:Acbd6 UTSW 1 155687004 missense probably damaging 1.00
R7960:Acbd6 UTSW 1 155687020 missense probably benign 0.02
R8762:Acbd6 UTSW 1 155686960 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCAGAATCACCTGAGAC -3'
(R):5'- TTTTGGAGGAAACAGCCCACG -3'

Sequencing Primer
(F):5'- TGAGACCGCCAGACAGCTC -3'
(R):5'- GAGGAAACAGCCCACGTCCTC -3'
Posted On2014-10-15