Incidental Mutation 'R2234:Olfr1089'
ID 239904
Institutional Source Beutler Lab
Gene Symbol Olfr1089
Ensembl Gene ENSMUSG00000111711
Gene Name olfactory receptor 1089
Synonyms MOR193-1, GA_x6K02T2Q125-48226321-48225386
MMRRC Submission 040235-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R2234 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 86732584-86733701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86733577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 12 (F12L)
Ref Sequence ENSEMBL: ENSMUSP00000149509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214317]
AlphaFold A0A1L1SRK6
Predicted Effect possibly damaging
Transcript: ENSMUST00000099876
AA Change: F12L

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097461
Gene: ENSMUSG00000075173
AA Change: F12L

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 4.7e-47 PFAM
Pfam:7tm_1 41 290 2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214317
AA Change: F12L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Akap8l C T 17: 32,338,803 G37R probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Cd81 T A 7: 143,066,319 N71K probably benign Het
Cemip G T 7: 83,998,562 D103E probably benign Het
Chfr A G 5: 110,170,863 K580E probably damaging Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cpb1 A T 3: 20,275,465 D32E probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
Eml5 A C 12: 98,841,581 D984E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hspa2 A G 12: 76,404,645 T38A possibly damaging Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kalrn C A 16: 34,176,262 probably null Het
Kmt2d T C 15: 98,865,248 D240G probably damaging Het
Lrrc56 T A 7: 141,198,294 D66E probably damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1219 A G 2: 89,074,248 L281P probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr710 C A 7: 106,944,620 C127F probably damaging Het
Olfr832 A T 9: 18,944,816 H56L probably damaging Het
Pax8 A G 2: 24,443,102 I77T probably damaging Het
Paxbp1 T C 16: 91,034,934 I355M probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Plec A T 15: 76,176,947 I2952N probably damaging Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Ssc5d A G 7: 4,943,850 T1068A probably benign Het
Stambp A G 6: 83,551,978 S362P probably damaging Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tnk1 C T 11: 69,855,191 probably null Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xpnpep1 T G 19: 53,013,461 D118A probably damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Other mutations in Olfr1089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1089 APN 2 86733235 missense possibly damaging 0.90
IGL00944:Olfr1089 APN 2 86733561 missense possibly damaging 0.80
IGL01478:Olfr1089 APN 2 86733329 nonsense probably null
IGL01636:Olfr1089 APN 2 86733601 nonsense probably null
IGL01887:Olfr1089 APN 2 86732686 missense probably benign 0.03
IGL02008:Olfr1089 APN 2 86733177 missense possibly damaging 0.90
IGL02470:Olfr1089 APN 2 86733585 missense probably damaging 0.97
IGL02560:Olfr1089 APN 2 86733234 missense probably damaging 1.00
R1782:Olfr1089 UTSW 2 86732682 missense probably benign 0.03
R2866:Olfr1089 UTSW 2 86733429 missense possibly damaging 0.95
R3027:Olfr1089 UTSW 2 86733586 missense possibly damaging 0.79
R4275:Olfr1089 UTSW 2 86733592 missense probably damaging 1.00
R4799:Olfr1089 UTSW 2 86732674 splice site probably null
R5016:Olfr1089 UTSW 2 86732746 missense probably benign 0.17
R5154:Olfr1089 UTSW 2 86732777 nonsense probably null
R5355:Olfr1089 UTSW 2 86733336 missense probably damaging 1.00
R5624:Olfr1089 UTSW 2 86732805 missense probably benign 0.45
R6265:Olfr1089 UTSW 2 86732955 missense probably damaging 0.99
R7382:Olfr1089 UTSW 2 86732785 missense probably benign 0.02
R8009:Olfr1089 UTSW 2 86733504 missense probably damaging 0.99
R8850:Olfr1089 UTSW 2 86732958 missense probably damaging 0.99
R9652:Olfr1089 UTSW 2 86733292 missense probably damaging 1.00
X0028:Olfr1089 UTSW 2 86732748 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGACAGCCAAGTGTTTGAG -3'
(R):5'- CTCCAAGTTGAGCCATTGAAC -3'

Sequencing Primer
(F):5'- GAAAGAAGTACATGGGTGTTTGC -3'
(R):5'- CAAGTTGAGCCATTGAACTATGTTTC -3'
Posted On 2014-10-15