Mutagenetix > Incidental Mutations

Incidental Mutation 'R0184:Iars'

23991

Institutional Source

Beutler Lab

Gene Symbol

Iars

Ensembl Gene

ENSMUSG00000037851

Gene Name

isoleucine-tRNA synthetase

Synonyms

E430001P04Rik, 2510016L12Rik

MMRRC Submission

038449-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0184 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

49682100-49734267 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 49722212 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 792 (S792A)

Ref Sequence

ENSEMBL: ENSMUSP00000132082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000165316]

Predicted Effect

probably benign
Transcript: ENSMUST00000047363
AA Change: S792A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851
AA Change: S792A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	9.2e-242	PFAM
Pfam:tRNA-synt_1g	46	197	3.7e-6	PFAM
Pfam:Anticodon_1	693	852	1.1e-23	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164260
AA Change: S792A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851
AA Change: S792A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165270

Predicted Effect

probably benign
Transcript: ENSMUST00000165316
AA Change: S792A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851
AA Change: S792A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165656

Meta Mutation Damage Score

0.0887

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.9%

Validation Efficiency

66% (50/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	A	3: 124,419,250	V131F	probably damaging	Het
Adam28	T	C	14: 68,637,373	D285G	probably benign	Het
Akr1c13	A	G	13: 4,194,056	E36G	probably damaging	Het
Antxr2	A	G	5: 97,980,030	L214S	probably damaging	Het
Arhgap26	T	A	18: 38,617,673	D46E	unknown	Het
Armc9	T	C	1: 86,198,370	L61P	probably damaging	Het
Bicc1	C	A	10: 71,079,215	R73L	probably benign	Het
Calm2	T	C	17: 87,435,841	N43S	probably benign	Het
Cct7	A	G	6: 85,461,554	D105G	probably null	Het
Cdk18	T	C	1: 132,118,538	N215D	probably benign	Het
Cep126	T	C	9: 8,103,395	T205A	probably benign	Het
Cfap57	A	T	4: 118,599,012	I495N	probably damaging	Het
Cyp2b9	T	A	7: 26,187,007	C152*	probably null	Het
Dab2ip	G	A	2: 35,718,791	R579H	probably damaging	Het
Dnah8	T	C	17: 30,683,683	V905A	probably benign	Het
Eif4h	C	A	5: 134,625,375	D134Y	possibly damaging	Het
Espl1	T	A	15: 102,299,216	S372T	probably benign	Het
Fat2	T	A	11: 55,296,288	H1244L	probably damaging	Het
Fbxo11	T	A	17: 88,008,673	N443I	probably benign	Het
Git2	G	A	5: 114,739,037	T128M	possibly damaging	Het
Gm10985	T	A	3: 53,845,258	Y21N	probably damaging	Het
Gm12790	A	T	4: 101,967,614	Y152*	probably null	Het
Heatr5a	T	C	12: 51,909,969	D1115G	probably benign	Het
Hipk2	T	C	6: 38,718,931	N726S	possibly damaging	Het
Hrg	T	C	16: 22,953,771		probably null	Het
Igf1r	A	G	7: 68,226,193	N1301S	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Ilkap	T	C	1: 91,376,305		probably benign	Het
Ints13	A	T	6: 146,555,044	Y435N	probably benign	Het
Ints8	A	C	4: 11,218,637	S797A	probably benign	Het
Itgad	T	A	7: 128,189,231	D405E	probably benign	Het
Itgam	A	T	7: 128,086,058	I448F	probably damaging	Het
Klk1	C	T	7: 44,228,749	T41I	possibly damaging	Het
Mcrip1	T	C	11: 120,544,884	M1V	probably null	Het
Mdga1	A	G	17: 29,852,442	Y128H	probably damaging	Het
Mtor	G	T	4: 148,464,971	R604L	probably benign	Het
Olfr1170	A	T	2: 88,224,780	L84*	probably null	Het
Olfr656	T	C	7: 104,618,240	V187A	probably damaging	Het
Pcdhb7	T	A	18: 37,343,390	D526E	probably benign	Het
Pip4k2a	T	C	2: 18,889,128	D139G	probably damaging	Het
Pkp3	A	C	7: 141,088,367	N536T	probably benign	Het
Pla2g4c	T	A	7: 13,356,220	S524T	probably benign	Het
Pno1	T	C	11: 17,211,127	E69G	probably benign	Het
Pold1	C	T	7: 44,541,715	V231M	probably benign	Het
Poli	A	G	18: 70,522,731	S248P	probably damaging	Het
Ppox	C	T	1: 171,279,552	S138N	probably damaging	Het
Psg20	T	C	7: 18,685,976	E6G	probably null	Het
Rbmx	C	T	X: 57,391,566		probably null	Het
Rln1	T	A	19: 29,331,936	K148*	probably null	Het
Rnf213	C	T	11: 119,414,521	T526I	probably damaging	Het
Rps6kc1	A	T	1: 190,799,093	V904E	probably null	Het
Sf3b2	T	A	19: 5,283,672	I633F	probably damaging	Het
Sfswap	T	A	5: 129,507,189	I189N	probably damaging	Het
Smarca2	T	A	19: 26,692,249	Y973*	probably null	Het
Spink5	G	A	18: 44,003,198	D559N	probably benign	Het
Spty2d1	C	T	7: 46,997,574	V536I	possibly damaging	Het
Tbx3	T	C	5: 119,675,562	I221T	probably damaging	Het
Tcf20	T	A	15: 82,852,300	D1650V	probably damaging	Het
Thsd7b	A	G	1: 129,430,964	K45R	probably benign	Het
Tirap	A	G	9: 35,189,194	S65P	probably benign	Het
Trim25	C	T	11: 88,999,640	P51L	probably damaging	Het
Trim61	T	C	8: 65,014,417	N64S	probably benign	Het
Twf1	T	A	15: 94,581,067		probably null	Het
Ubr4	A	C	4: 139,445,262	T1692P	probably damaging	Het
Usp3	A	G	9: 66,562,581	M86T	probably damaging	Het
Utrn	T	C	10: 12,667,618	D1762G	probably benign	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Vmn2r52	T	C	7: 10,159,338	S625G	probably damaging	Het
Vmn2r90	G	A	17: 17,726,877	W472*	probably null	Het
Vrk2	C	A	11: 26,550,046	A56S	probably damaging	Het
Yeats2	C	T	16: 20,203,685	P620S	possibly damaging	Het
Zbtb21	C	T	16: 97,950,513	D171N	probably damaging	Het
Zeb1	A	T	18: 5,766,808	I440F	probably damaging	Het
Zfp292	A	G	4: 34,819,563	I253T	probably damaging	Het

Other mutations in Iars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00697:Iars	APN	13	49709728	missense	probably damaging	1.00
IGL00764:Iars	APN	13	49711827	missense	probably benign	0.34
IGL01153:Iars	APN	13	49711805	missense	probably damaging	1.00
IGL01481:Iars	APN	13	49728698	missense	probably benign	0.00
IGL01596:Iars	APN	13	49703176	missense	probably benign
IGL01682:Iars	APN	13	49709658	missense	probably damaging	1.00
IGL01885:Iars	APN	13	49691499	missense	probably benign	0.25
IGL01907:Iars	APN	13	49709655	missense	probably damaging	1.00
IGL02023:Iars	APN	13	49688249	missense	probably damaging	1.00
IGL02121:Iars	APN	13	49724696	missense	probably benign	0.00
IGL02365:Iars	APN	13	49691499	missense	probably benign	0.25
IGL02704:Iars	APN	13	49721100	missense	probably damaging	1.00
IGL02838:Iars	APN	13	49690489	missense	possibly damaging	0.87
IGL02975:Iars	APN	13	49704849	missense	probably damaging	1.00
IGL02982:Iars	APN	13	49709709	missense	probably benign	0.00
IGL03034:Iars	APN	13	49690489	missense	possibly damaging	0.87
IGL03060:Iars	APN	13	49690447	critical splice acceptor site	probably null
IGL03156:Iars	APN	13	49703179	missense	possibly damaging	0.87
IGL03206:Iars	APN	13	49693070	missense	possibly damaging	0.81
IGL03343:Iars	APN	13	49724747	missense	probably benign	0.12
gannett_peak	UTSW	13	49708421	missense	probably damaging	1.00
spacex	UTSW	13	49723002	missense	possibly damaging	0.85
wind_river	UTSW	13	49701895	missense	probably damaging	1.00
R0054:Iars	UTSW	13	49693135	missense	probably damaging	1.00
R0054:Iars	UTSW	13	49693135	missense	probably damaging	1.00
R0200:Iars	UTSW	13	49726202	missense	possibly damaging	0.62
R0356:Iars	UTSW	13	49703233	missense	probably benign	0.03
R0383:Iars	UTSW	13	49732342	missense	probably damaging	0.99
R0657:Iars	UTSW	13	49702519	missense	probably damaging	1.00
R1005:Iars	UTSW	13	49687445	missense	possibly damaging	0.94
R1427:Iars	UTSW	13	49704269	critical splice acceptor site	probably null
R1449:Iars	UTSW	13	49733710	missense	probably damaging	0.99
R1647:Iars	UTSW	13	49723002	missense	possibly damaging	0.85
R1648:Iars	UTSW	13	49723002	missense	possibly damaging	0.85
R1664:Iars	UTSW	13	49711775	missense	probably damaging	0.98
R1763:Iars	UTSW	13	49723077	critical splice donor site	probably null
R2192:Iars	UTSW	13	49688129	splice site	probably null
R2203:Iars	UTSW	13	49722675	missense	probably benign	0.00
R2357:Iars	UTSW	13	49688203	missense	probably damaging	1.00
R3724:Iars	UTSW	13	49687384	critical splice acceptor site	probably null
R4785:Iars	UTSW	13	49724663	missense	probably damaging	0.99
R4934:Iars	UTSW	13	49717984	missense	probably benign	0.17
R4999:Iars	UTSW	13	49709661	missense	probably damaging	1.00
R5048:Iars	UTSW	13	49688237	missense	probably damaging	0.99
R5268:Iars	UTSW	13	49690491	missense	probably damaging	1.00
R5394:Iars	UTSW	13	49722165	missense	probably damaging	1.00
R5486:Iars	UTSW	13	49709573	splice site	probably null
R5960:Iars	UTSW	13	49724637	missense	possibly damaging	0.68
R5972:Iars	UTSW	13	49709632	missense	possibly damaging	0.91
R5978:Iars	UTSW	13	49722993	missense	probably damaging	0.99
R6031:Iars	UTSW	13	49705831	missense	probably damaging	0.98
R6031:Iars	UTSW	13	49705831	missense	probably damaging	0.98
R6092:Iars	UTSW	13	49708421	missense	probably damaging	1.00
R6167:Iars	UTSW	13	49722714	missense	probably damaging	1.00
R6313:Iars	UTSW	13	49708445	missense	probably damaging	0.99
R6358:Iars	UTSW	13	49727143	missense	possibly damaging	0.67
R6385:Iars	UTSW	13	49701895	missense	probably damaging	1.00
R6403:Iars	UTSW	13	49687495	missense	probably damaging	1.00
R6575:Iars	UTSW	13	49725269	missense	probably damaging	1.00
R6675:Iars	UTSW	13	49719578	missense	probably damaging	0.99
R6957:Iars	UTSW	13	49722161	missense	probably damaging	1.00
R7207:Iars	UTSW	13	49688315	critical splice donor site	probably null
R7254:Iars	UTSW	13	49723078	critical splice donor site	probably null
R7354:Iars	UTSW	13	49704320	missense	probably benign
R7397:Iars	UTSW	13	49728677	missense	probably benign	0.00
R7696:Iars	UTSW	13	49706738	missense	probably damaging	1.00
R7799:Iars	UTSW	13	49723018	missense	probably damaging	1.00
R7828:Iars	UTSW	13	49725272	missense	probably benign
R8768:Iars	UTSW	13	49724626	missense	probably damaging	0.99
R8797:Iars	UTSW	13	49688262	missense	probably benign	0.12
Z1088:Iars	UTSW	13	49721088	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCCTATGCCTGTCTGTGTATTGC -3'
(R):5'- AAGGAGGATGCTATACCCCTGCTAC -3'

Sequencing Primer
(F):5'- GCTATTCTCCTCTCTAAAGTGACTGG -3'
(R):5'- TGCAGCCTGAGGAGTAGC -3'

Posted On

2013-04-16