Incidental Mutation 'R2234:Chfr'
ID 239914
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission 040235-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R2234 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110170863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 580 (K580E)
Ref Sequence ENSEMBL: ENSMUSP00000143480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557]
AlphaFold Q810L3
Predicted Effect probably damaging
Transcript: ENSMUST00000014812
AA Change: K651E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: K651E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112519
AA Change: K652E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: K652E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197010
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably damaging
Transcript: ENSMUST00000198633
AA Change: K580E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: K580E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Akap8l C T 17: 32,338,803 G37R probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Cd81 T A 7: 143,066,319 N71K probably benign Het
Cemip G T 7: 83,998,562 D103E probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cpb1 A T 3: 20,275,465 D32E probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
Eml5 A C 12: 98,841,581 D984E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hspa2 A G 12: 76,404,645 T38A possibly damaging Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kalrn C A 16: 34,176,262 probably null Het
Kmt2d T C 15: 98,865,248 D240G probably damaging Het
Lrrc56 T A 7: 141,198,294 D66E probably damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1089 A G 2: 86,733,577 F12L possibly damaging Het
Olfr1219 A G 2: 89,074,248 L281P probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr710 C A 7: 106,944,620 C127F probably damaging Het
Olfr832 A T 9: 18,944,816 H56L probably damaging Het
Pax8 A G 2: 24,443,102 I77T probably damaging Het
Paxbp1 T C 16: 91,034,934 I355M probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Plec A T 15: 76,176,947 I2952N probably damaging Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Ssc5d A G 7: 4,943,850 T1068A probably benign Het
Stambp A G 6: 83,551,978 S362P probably damaging Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tnk1 C T 11: 69,855,191 probably null Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xpnpep1 T G 19: 53,013,461 D118A probably damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
R9419:Chfr UTSW 5 110169190 missense not run
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCACAGCTCTTGTTCTATG -3'
(R):5'- ACGATGACGCTCCACAAAGG -3'

Sequencing Primer
(F):5'- AGACAACTTAGTTTGGCTCCCAG -3'
(R):5'- GATGACGCTCCACAAAGGGAAAATC -3'
Posted On 2014-10-15