Mutagenetix > Incidental Mutations

Incidental Mutation 'R2234:Chfr'

239914

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

040235-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R2234 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110170863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 580 (K580E)

Ref Sequence

ENSEMBL: ENSMUSP00000143480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557]

AlphaFold

Q810L3

Predicted Effect

probably damaging
Transcript: ENSMUST00000014812
AA Change: K651E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: K651E

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112519
AA Change: K652E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: K652E

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125250

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130892

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132210

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135366

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141008

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197010

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

probably damaging
Transcript: ENSMUST00000198633
AA Change: K580E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: K580E

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	A	G	1: 155,558,708	D24G	probably damaging	Het
Adarb1	A	G	10: 77,317,349	V322A	probably damaging	Het
Akap8l	C	T	17: 32,338,803	G37R	probably damaging	Het
BC035947	A	T	1: 78,497,962	D644E	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Ccdc129	A	T	6: 55,897,812	H249L	possibly damaging	Het
Cd81	T	A	7: 143,066,319	N71K	probably benign	Het
Cemip	G	T	7: 83,998,562	D103E	probably benign	Het
Chrnb1	A	T	11: 69,795,602	I64N	probably damaging	Het
Clca1	G	T	3: 145,009,068	P596Q	possibly damaging	Het
Cpb1	A	T	3: 20,275,465	D32E	probably benign	Het
Crh	A	T	3: 19,693,932	M182K	probably damaging	Het
Csta1	C	T	16: 36,125,075	V23I	probably damaging	Het
Dazap1	A	G	10: 80,277,599	K110E	possibly damaging	Het
Dhx16	T	C	17: 35,887,886	C737R	probably damaging	Het
Dync1i2	C	T	2: 71,249,420	Q419*	probably null	Het
Eml5	A	C	12: 98,841,581	D984E	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm12695	C	T	4: 96,724,029	R499Q	probably damaging	Het
Hid1	A	G	11: 115,351,119	I555T	probably damaging	Het
Hspa2	A	G	12: 76,404,645	T38A	possibly damaging	Het
Igf1r	T	A	7: 68,212,080	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,480,638	E34G	probably damaging	Het
Kalrn	C	A	16: 34,176,262		probably null	Het
Kmt2d	T	C	15: 98,865,248	D240G	probably damaging	Het
Lrrc56	T	A	7: 141,198,294	D66E	probably damaging	Het
Myot	A	G	18: 44,354,272	D392G	probably damaging	Het
Nphp3	G	A	9: 104,037,376	R1052H	probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1089	A	G	2: 86,733,577	F12L	possibly damaging	Het
Olfr1219	A	G	2: 89,074,248	L281P	probably damaging	Het
Olfr1346	T	C	7: 6,474,442	S111P	possibly damaging	Het
Olfr710	C	A	7: 106,944,620	C127F	probably damaging	Het
Olfr832	A	T	9: 18,944,816	H56L	probably damaging	Het
Pax8	A	G	2: 24,443,102	I77T	probably damaging	Het
Paxbp1	T	C	16: 91,034,934	I355M	probably benign	Het
Pds5a	A	T	5: 65,654,098	F331I	probably damaging	Het
Plec	A	T	15: 76,176,947	I2952N	probably damaging	Het
Ppp1r12a	A	G	10: 108,198,919	I108M	possibly damaging	Het
Rabepk	A	T	2: 34,795,234	I58N	possibly damaging	Het
Rnf216	G	A	5: 143,090,926	H68Y	probably benign	Het
Scap	T	C	9: 110,381,593	C998R	probably damaging	Het
Scgb1b27	T	C	7: 34,021,824	Y46H	probably damaging	Het
Sf3a2	G	T	10: 80,802,829	A95S	probably benign	Het
Smg7	A	T	1: 152,868,313	Y40N	probably damaging	Het
Ssc5d	A	G	7: 4,943,850	T1068A	probably benign	Het
Stambp	A	G	6: 83,551,978	S362P	probably damaging	Het
Tbx18	G	T	9: 87,724,350	S247R	probably damaging	Het
Tenm3	T	C	8: 48,276,169	I1601V	probably benign	Het
Thap4	G	T	1: 93,725,212	Q441K	probably benign	Het
Tmprss11c	G	T	5: 86,282,086	T40K	probably benign	Het
Tnk1	C	T	11: 69,855,191		probably null	Het
Trim65	G	T	11: 116,130,677	T110K	possibly damaging	Het
Uck1	T	C	2: 32,258,303	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,049,665	H61L	possibly damaging	Het
Xpnpep1	T	G	19: 53,013,461	D118A	probably damaging	Het
Xylt2	C	T	11: 94,669,996	V239M	possibly damaging	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
R9024:Chfr	UTSW	5	110158832	missense	probably benign	0.26
R9419:Chfr	UTSW	5	110169190	missense	not run
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGCACAGCTCTTGTTCTATG -3'
(R):5'- ACGATGACGCTCCACAAAGG -3'

Sequencing Primer
(F):5'- AGACAACTTAGTTTGGCTCCCAG -3'
(R):5'- GATGACGCTCCACAAAGGGAAAATC -3'

Posted On

2014-10-15