Mutagenetix > Incidental Mutations

Incidental Mutation 'R2234:Olfr1346'

239919

Institutional Source

Beutler Lab

Gene Symbol

Olfr1346

Ensembl Gene

ENSMUSG00000054938

Gene Name

olfactory receptor 1346

Synonyms

MOR103-6, GA_x6K02T2QGBW-3203957-3204898

MMRRC Submission

040235-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R2234 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6467101-6478112 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 6474442 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 111 (S111P)

Ref Sequence

ENSEMBL: ENSMUSP00000150503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056144] [ENSMUST00000207658] [ENSMUST00000209866] [ENSMUST00000215302]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056144
AA Change: S111P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000050553
Gene: ENSMUSG00000054938
AA Change: S111P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	312	7.2e-44	PFAM
Pfam:7tm_1	45	295	5.4e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207658
AA Change: S111P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000209866

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215302
AA Change: S111P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	A	G	1: 155,558,708	D24G	probably damaging	Het
Adarb1	A	G	10: 77,317,349	V322A	probably damaging	Het
Akap8l	C	T	17: 32,338,803	G37R	probably damaging	Het
BC035947	A	T	1: 78,497,962	D644E	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Ccdc129	A	T	6: 55,897,812	H249L	possibly damaging	Het
Cd81	T	A	7: 143,066,319	N71K	probably benign	Het
Cemip	G	T	7: 83,998,562	D103E	probably benign	Het
Chfr	A	G	5: 110,170,863	K580E	probably damaging	Het
Chrnb1	A	T	11: 69,795,602	I64N	probably damaging	Het
Clca1	G	T	3: 145,009,068	P596Q	possibly damaging	Het
Cpb1	A	T	3: 20,275,465	D32E	probably benign	Het
Crh	A	T	3: 19,693,932	M182K	probably damaging	Het
Csta1	C	T	16: 36,125,075	V23I	probably damaging	Het
Dazap1	A	G	10: 80,277,599	K110E	possibly damaging	Het
Dhx16	T	C	17: 35,887,886	C737R	probably damaging	Het
Dync1i2	C	T	2: 71,249,420	Q419*	probably null	Het
Eml5	A	C	12: 98,841,581	D984E	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm12695	C	T	4: 96,724,029	R499Q	probably damaging	Het
Hid1	A	G	11: 115,351,119	I555T	probably damaging	Het
Hspa2	A	G	12: 76,404,645	T38A	possibly damaging	Het
Igf1r	T	A	7: 68,212,080	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,480,638	E34G	probably damaging	Het
Kalrn	C	A	16: 34,176,262		probably null	Het
Kmt2d	T	C	15: 98,865,248	D240G	probably damaging	Het
Lrrc56	T	A	7: 141,198,294	D66E	probably damaging	Het
Myot	A	G	18: 44,354,272	D392G	probably damaging	Het
Nphp3	G	A	9: 104,037,376	R1052H	probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1089	A	G	2: 86,733,577	F12L	possibly damaging	Het
Olfr1219	A	G	2: 89,074,248	L281P	probably damaging	Het
Olfr710	C	A	7: 106,944,620	C127F	probably damaging	Het
Olfr832	A	T	9: 18,944,816	H56L	probably damaging	Het
Pax8	A	G	2: 24,443,102	I77T	probably damaging	Het
Paxbp1	T	C	16: 91,034,934	I355M	probably benign	Het
Pds5a	A	T	5: 65,654,098	F331I	probably damaging	Het
Plec	A	T	15: 76,176,947	I2952N	probably damaging	Het
Ppp1r12a	A	G	10: 108,198,919	I108M	possibly damaging	Het
Rabepk	A	T	2: 34,795,234	I58N	possibly damaging	Het
Rnf216	G	A	5: 143,090,926	H68Y	probably benign	Het
Scap	T	C	9: 110,381,593	C998R	probably damaging	Het
Scgb1b27	T	C	7: 34,021,824	Y46H	probably damaging	Het
Sf3a2	G	T	10: 80,802,829	A95S	probably benign	Het
Smg7	A	T	1: 152,868,313	Y40N	probably damaging	Het
Ssc5d	A	G	7: 4,943,850	T1068A	probably benign	Het
Stambp	A	G	6: 83,551,978	S362P	probably damaging	Het
Tbx18	G	T	9: 87,724,350	S247R	probably damaging	Het
Tenm3	T	C	8: 48,276,169	I1601V	probably benign	Het
Thap4	G	T	1: 93,725,212	Q441K	probably benign	Het
Tmprss11c	G	T	5: 86,282,086	T40K	probably benign	Het
Tnk1	C	T	11: 69,855,191		probably null	Het
Trim65	G	T	11: 116,130,677	T110K	possibly damaging	Het
Uck1	T	C	2: 32,258,303	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,049,665	H61L	possibly damaging	Het
Xpnpep1	T	G	19: 53,013,461	D118A	probably damaging	Het
Xylt2	C	T	11: 94,669,996	V239M	possibly damaging	Het

Other mutations in Olfr1346

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0057:Olfr1346	UTSW	7	6474680	missense	probably damaging	1.00
R0446:Olfr1346	UTSW	7	6475025	missense	probably benign	0.00
R0531:Olfr1346	UTSW	7	6474235	missense	possibly damaging	0.81
R0622:Olfr1346	UTSW	7	6474599	missense	possibly damaging	0.46
R1596:Olfr1346	UTSW	7	6474515	missense	probably damaging	1.00
R2233:Olfr1346	UTSW	7	6474442	missense	possibly damaging	0.94
R2235:Olfr1346	UTSW	7	6474442	missense	possibly damaging	0.94
R4441:Olfr1346	UTSW	7	6474925	missense	probably benign	0.01
R4888:Olfr1346	UTSW	7	6474613	missense	probably damaging	0.97
R4890:Olfr1346	UTSW	7	6474849	nonsense	probably null
R5696:Olfr1346	UTSW	7	6474743	splice site	probably null
R6173:Olfr1346	UTSW	7	6474836	missense	probably damaging	1.00
R6643:Olfr1346	UTSW	7	6474721	missense	probably benign	0.11
R7404:Olfr1346	UTSW	7	6474164	missense	probably damaging	1.00
R8120:Olfr1346	UTSW	7	6474120	missense	probably benign	0.02
Z1177:Olfr1346	UTSW	7	6474390	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- AAGACATCAAGGACGGCCTG -3'
(R):5'- GTGGTCTTGATCGCAGAAAC -3'

Sequencing Primer
(F):5'- CCTGCTGATCTTCCTAGAGAATATG -3'
(R):5'- GGTCTTGATCGCAGAAACCAACAG -3'

Posted On

2014-10-15