Mutagenetix > Incidental Mutation

Incidental Mutation 'R2234:Igf1r'

239923

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

IGF-1R, line 186, A330103N21Rik, hyft, CD221

MMRRC Submission

040235-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2234 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67602575-67883416 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67861828 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1129 (N1129K)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005671
AA Change: N1129K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: N1129K

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208731

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208871

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	A	G	1: 155,434,454 (GRCm39)	D24G	probably damaging	Het
Adarb1	A	G	10: 77,153,183 (GRCm39)	V322A	probably damaging	Het
Akap8l	C	T	17: 32,557,777 (GRCm39)	G37R	probably damaging	Het
BC035947	A	T	1: 78,474,599 (GRCm39)	D644E	probably damaging	Het
Capzb	T	A	4: 138,989,334 (GRCm39)	D85E	possibly damaging	Het
Cd81	T	A	7: 142,620,056 (GRCm39)	N71K	probably benign	Het
Cemip	G	T	7: 83,647,770 (GRCm39)	D103E	probably benign	Het
Chfr	A	G	5: 110,318,729 (GRCm39)	K580E	probably damaging	Het
Chrnb1	A	T	11: 69,686,428 (GRCm39)	I64N	probably damaging	Het
Clca3a1	G	T	3: 144,714,829 (GRCm39)	P596Q	possibly damaging	Het
Cpb1	A	T	3: 20,329,629 (GRCm39)	D32E	probably benign	Het
Crh	A	T	3: 19,748,096 (GRCm39)	M182K	probably damaging	Het
Csta1	C	T	16: 35,945,445 (GRCm39)	V23I	probably damaging	Het
Dazap1	A	G	10: 80,113,433 (GRCm39)	K110E	possibly damaging	Het
Dhx16	T	C	17: 36,198,778 (GRCm39)	C737R	probably damaging	Het
Dync1i2	C	T	2: 71,079,764 (GRCm39)	Q419*	probably null	Het
Eml5	A	C	12: 98,807,840 (GRCm39)	D984E	probably damaging	Het
Fat3	G	A	9: 15,909,567 (GRCm39)	S2145F	probably damaging	Het
Gm12695	C	T	4: 96,612,266 (GRCm39)	R499Q	probably damaging	Het
Hid1	A	G	11: 115,241,945 (GRCm39)	I555T	probably damaging	Het
Hspa2	A	G	12: 76,451,419 (GRCm39)	T38A	possibly damaging	Het
Iglon5	T	C	7: 43,130,062 (GRCm39)	E34G	probably damaging	Het
Itprid1	A	T	6: 55,874,797 (GRCm39)	H249L	possibly damaging	Het
Kalrn	C	A	16: 33,996,632 (GRCm39)		probably null	Het
Kmt2d	T	C	15: 98,763,129 (GRCm39)	D240G	probably damaging	Het
Lrrc56	T	A	7: 140,778,207 (GRCm39)	D66E	probably damaging	Het
Myot	A	G	18: 44,487,339 (GRCm39)	D392G	probably damaging	Het
Nphp3	G	A	9: 103,914,575 (GRCm39)	R1052H	probably benign	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or2d4	C	A	7: 106,543,827 (GRCm39)	C127F	probably damaging	Het
Or4c114	A	G	2: 88,904,592 (GRCm39)	L281P	probably damaging	Het
Or6z5	T	C	7: 6,477,441 (GRCm39)	S111P	possibly damaging	Het
Or7g19	A	T	9: 18,856,112 (GRCm39)	H56L	probably damaging	Het
Or8k39	A	G	2: 86,563,921 (GRCm39)	F12L	possibly damaging	Het
Pax8	A	G	2: 24,333,114 (GRCm39)	I77T	probably damaging	Het
Paxbp1	T	C	16: 90,831,822 (GRCm39)	I355M	probably benign	Het
Pds5a	A	T	5: 65,811,441 (GRCm39)	F331I	probably damaging	Het
Plec	A	T	15: 76,061,147 (GRCm39)	I2952N	probably damaging	Het
Ppp1r12a	A	G	10: 108,034,780 (GRCm39)	I108M	possibly damaging	Het
Rabepk	A	T	2: 34,685,246 (GRCm39)	I58N	possibly damaging	Het
Rnf216	G	A	5: 143,076,681 (GRCm39)	H68Y	probably benign	Het
Scap	T	C	9: 110,210,661 (GRCm39)	C998R	probably damaging	Het
Scgb1b27	T	C	7: 33,721,249 (GRCm39)	Y46H	probably damaging	Het
Sf3a2	G	T	10: 80,638,663 (GRCm39)	A95S	probably benign	Het
Smg7	A	T	1: 152,744,064 (GRCm39)	Y40N	probably damaging	Het
Ssc5d	A	G	7: 4,946,849 (GRCm39)	T1068A	probably benign	Het
Stambp	A	G	6: 83,528,960 (GRCm39)	S362P	probably damaging	Het
Tbx18	G	T	9: 87,606,403 (GRCm39)	S247R	probably damaging	Het
Tenm3	T	C	8: 48,729,204 (GRCm39)	I1601V	probably benign	Het
Thap4	G	T	1: 93,652,934 (GRCm39)	Q441K	probably benign	Het
Tmprss11c	G	T	5: 86,429,945 (GRCm39)	T40K	probably benign	Het
Tnk1	C	T	11: 69,746,017 (GRCm39)		probably null	Het
Trim65	G	T	11: 116,021,503 (GRCm39)	T110K	possibly damaging	Het
Uck1	T	C	2: 32,148,315 (GRCm39)	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,269,927 (GRCm39)	H61L	possibly damaging	Het
Xpnpep1	T	G	19: 53,001,892 (GRCm39)	D118A	probably damaging	Het
Xylt2	C	T	11: 94,560,822 (GRCm39)	V239M	possibly damaging	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	67,839,771 (GRCm39)	missense	probably benign
IGL00837:Igf1r	APN	7	67,851,100 (GRCm39)	splice site	probably benign
IGL01515:Igf1r	APN	7	67,857,200 (GRCm39)	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	67,843,189 (GRCm39)	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	67,839,706 (GRCm39)	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	67,843,144 (GRCm39)	missense	probably benign
IGL02672:Igf1r	APN	7	67,839,781 (GRCm39)	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	67,850,997 (GRCm39)	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	67,839,739 (GRCm39)	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	67,864,791 (GRCm39)	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	67,864,688 (GRCm39)	missense	probably damaging	1.00
Frufru	UTSW	7	67,653,911 (GRCm39)	missense	probably damaging	1.00
Hungarian	UTSW	7	67,864,745 (GRCm39)	missense	probably damaging	1.00
Mimi	UTSW	7	67,844,774 (GRCm39)	missense	possibly damaging	0.67
Piroshka	UTSW	7	67,857,084 (GRCm39)	nonsense	probably null
Romanian	UTSW	7	67,653,885 (GRCm39)	missense	possibly damaging	0.94
Sublime	UTSW	7	67,653,927 (GRCm39)	missense	probably damaging	1.00
Toy	UTSW	7	67,653,720 (GRCm39)	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	67,861,802 (GRCm39)	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	67,861,802 (GRCm39)	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	67,875,934 (GRCm39)	small insertion	probably benign
FR4737:Igf1r	UTSW	7	67,875,929 (GRCm39)	small insertion	probably benign
FR4976:Igf1r	UTSW	7	67,875,934 (GRCm39)	small insertion	probably benign
FR4976:Igf1r	UTSW	7	67,875,929 (GRCm39)	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	67,857,211 (GRCm39)	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	67,814,990 (GRCm39)	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	67,875,941 (GRCm39)	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	67,857,574 (GRCm39)	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	67,814,903 (GRCm39)	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	67,861,906 (GRCm39)	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	67,861,839 (GRCm39)	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	67,844,774 (GRCm39)	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	67,814,875 (GRCm39)	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	67,868,216 (GRCm39)	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	67,653,585 (GRCm39)	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	67,857,617 (GRCm39)	missense	probably benign
R1745:Igf1r	UTSW	7	67,819,661 (GRCm39)	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	67,844,822 (GRCm39)	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	67,864,681 (GRCm39)	nonsense	probably null
R1823:Igf1r	UTSW	7	67,844,729 (GRCm39)	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	67,850,997 (GRCm39)	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	67,857,023 (GRCm39)	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	67,653,698 (GRCm39)	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	67,814,982 (GRCm39)	missense	probably benign
R2221:Igf1r	UTSW	7	67,851,710 (GRCm39)	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	67,861,828 (GRCm39)	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	67,861,828 (GRCm39)	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	67,833,147 (GRCm39)	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	67,839,810 (GRCm39)	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	67,844,826 (GRCm39)	nonsense	probably null
R4387:Igf1r	UTSW	7	67,819,757 (GRCm39)	missense	probably benign
R4388:Igf1r	UTSW	7	67,819,757 (GRCm39)	missense	probably benign
R4728:Igf1r	UTSW	7	67,839,372 (GRCm39)	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	67,814,947 (GRCm39)	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	67,857,067 (GRCm39)	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	67,843,166 (GRCm39)	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	67,843,107 (GRCm39)	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	67,833,258 (GRCm39)	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	67,857,569 (GRCm39)	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	67,857,001 (GRCm39)	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	67,839,781 (GRCm39)	missense	probably benign
R6189:Igf1r	UTSW	7	67,857,084 (GRCm39)	nonsense	probably null
R6262:Igf1r	UTSW	7	67,653,720 (GRCm39)	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	67,653,885 (GRCm39)	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	67,814,981 (GRCm39)	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	67,839,798 (GRCm39)	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	67,850,998 (GRCm39)	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	67,857,067 (GRCm39)	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	67,653,927 (GRCm39)	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	67,653,911 (GRCm39)	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	67,836,905 (GRCm39)	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	67,844,826 (GRCm39)	nonsense	probably null
R7442:Igf1r	UTSW	7	67,823,026 (GRCm39)	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	67,834,500 (GRCm39)	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	67,839,849 (GRCm39)	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	67,861,802 (GRCm39)	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	67,836,796 (GRCm39)	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	67,845,377 (GRCm39)	missense	probably benign
R8539:Igf1r	UTSW	7	67,653,596 (GRCm39)	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	67,819,802 (GRCm39)	splice site	probably benign
R8746:Igf1r	UTSW	7	67,864,745 (GRCm39)	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	67,875,769 (GRCm39)	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	67,875,769 (GRCm39)	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	67,833,211 (GRCm39)	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	67,833,186 (GRCm39)	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	67,861,775 (GRCm39)	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	67,844,746 (GRCm39)	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	67,857,001 (GRCm39)	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	67,864,682 (GRCm39)	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	67,857,554 (GRCm39)	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	67,839,423 (GRCm39)	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	67,654,065 (GRCm39)	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	67,875,927 (GRCm39)	small insertion	probably benign
RF032:Igf1r	UTSW	7	67,875,927 (GRCm39)	small insertion	probably benign
RF034:Igf1r	UTSW	7	67,875,924 (GRCm39)	small insertion	probably benign
RF037:Igf1r	UTSW	7	67,875,924 (GRCm39)	small insertion	probably benign
RF039:Igf1r	UTSW	7	67,875,924 (GRCm39)	small insertion	probably benign
RF044:Igf1r	UTSW	7	67,875,927 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,916 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,930 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,928 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,922 (GRCm39)	small insertion	probably benign
Z1186:Igf1r	UTSW	7	67,875,917 (GRCm39)	small insertion	probably benign
Z1191:Igf1r	UTSW	7	67,875,918 (GRCm39)	small insertion	probably benign
Z1191:Igf1r	UTSW	7	67,875,917 (GRCm39)	small insertion	probably benign
Z1191:Igf1r	UTSW	7	67,875,921 (GRCm39)	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGCAAGTCCTGACTCCCTG -3'
(R):5'- AAAATCTCTCCAGTGGCAGAC -3'

Sequencing Primer
(F):5'- CAGGTGACCTGTGGTACTCAG -3'
(R):5'- TCTCCAGTGGCAGACTAATGACTG -3'

Posted On

2014-10-15