Incidental Mutation 'R2234:Tbx18'
ID 239932
Institutional Source Beutler Lab
Gene Symbol Tbx18
Ensembl Gene ENSMUSG00000032419
Gene Name T-box18
Synonyms 2810012F10Rik, 2810404D13Rik
MMRRC Submission 040235-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2234 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 87584853-87613313 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 87606403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 247 (S247R)
Ref Sequence ENSEMBL: ENSMUSP00000034991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034991]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034991
AA Change: S247R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: S247R

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
TBOX 144 341 8.7e-127 SMART
low complexity region 461 476 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192660
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,434,454 (GRCm39) D24G probably damaging Het
Adarb1 A G 10: 77,153,183 (GRCm39) V322A probably damaging Het
Akap8l C T 17: 32,557,777 (GRCm39) G37R probably damaging Het
BC035947 A T 1: 78,474,599 (GRCm39) D644E probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cd81 T A 7: 142,620,056 (GRCm39) N71K probably benign Het
Cemip G T 7: 83,647,770 (GRCm39) D103E probably benign Het
Chfr A G 5: 110,318,729 (GRCm39) K580E probably damaging Het
Chrnb1 A T 11: 69,686,428 (GRCm39) I64N probably damaging Het
Clca3a1 G T 3: 144,714,829 (GRCm39) P596Q possibly damaging Het
Cpb1 A T 3: 20,329,629 (GRCm39) D32E probably benign Het
Crh A T 3: 19,748,096 (GRCm39) M182K probably damaging Het
Csta1 C T 16: 35,945,445 (GRCm39) V23I probably damaging Het
Dazap1 A G 10: 80,113,433 (GRCm39) K110E possibly damaging Het
Dhx16 T C 17: 36,198,778 (GRCm39) C737R probably damaging Het
Dync1i2 C T 2: 71,079,764 (GRCm39) Q419* probably null Het
Eml5 A C 12: 98,807,840 (GRCm39) D984E probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Gm12695 C T 4: 96,612,266 (GRCm39) R499Q probably damaging Het
Hid1 A G 11: 115,241,945 (GRCm39) I555T probably damaging Het
Hspa2 A G 12: 76,451,419 (GRCm39) T38A possibly damaging Het
Igf1r T A 7: 67,861,828 (GRCm39) N1129K probably damaging Het
Iglon5 T C 7: 43,130,062 (GRCm39) E34G probably damaging Het
Itprid1 A T 6: 55,874,797 (GRCm39) H249L possibly damaging Het
Kalrn C A 16: 33,996,632 (GRCm39) probably null Het
Kmt2d T C 15: 98,763,129 (GRCm39) D240G probably damaging Het
Lrrc56 T A 7: 140,778,207 (GRCm39) D66E probably damaging Het
Myot A G 18: 44,487,339 (GRCm39) D392G probably damaging Het
Nphp3 G A 9: 103,914,575 (GRCm39) R1052H probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or2d4 C A 7: 106,543,827 (GRCm39) C127F probably damaging Het
Or4c114 A G 2: 88,904,592 (GRCm39) L281P probably damaging Het
Or6z5 T C 7: 6,477,441 (GRCm39) S111P possibly damaging Het
Or7g19 A T 9: 18,856,112 (GRCm39) H56L probably damaging Het
Or8k39 A G 2: 86,563,921 (GRCm39) F12L possibly damaging Het
Pax8 A G 2: 24,333,114 (GRCm39) I77T probably damaging Het
Paxbp1 T C 16: 90,831,822 (GRCm39) I355M probably benign Het
Pds5a A T 5: 65,811,441 (GRCm39) F331I probably damaging Het
Plec A T 15: 76,061,147 (GRCm39) I2952N probably damaging Het
Ppp1r12a A G 10: 108,034,780 (GRCm39) I108M possibly damaging Het
Rabepk A T 2: 34,685,246 (GRCm39) I58N possibly damaging Het
Rnf216 G A 5: 143,076,681 (GRCm39) H68Y probably benign Het
Scap T C 9: 110,210,661 (GRCm39) C998R probably damaging Het
Scgb1b27 T C 7: 33,721,249 (GRCm39) Y46H probably damaging Het
Sf3a2 G T 10: 80,638,663 (GRCm39) A95S probably benign Het
Smg7 A T 1: 152,744,064 (GRCm39) Y40N probably damaging Het
Ssc5d A G 7: 4,946,849 (GRCm39) T1068A probably benign Het
Stambp A G 6: 83,528,960 (GRCm39) S362P probably damaging Het
Tenm3 T C 8: 48,729,204 (GRCm39) I1601V probably benign Het
Thap4 G T 1: 93,652,934 (GRCm39) Q441K probably benign Het
Tmprss11c G T 5: 86,429,945 (GRCm39) T40K probably benign Het
Tnk1 C T 11: 69,746,017 (GRCm39) probably null Het
Trim65 G T 11: 116,021,503 (GRCm39) T110K possibly damaging Het
Uck1 T C 2: 32,148,315 (GRCm39) D167G probably damaging Het
Vmn2r124 A T 17: 18,269,927 (GRCm39) H61L possibly damaging Het
Xpnpep1 T G 19: 53,001,892 (GRCm39) D118A probably damaging Het
Xylt2 C T 11: 94,560,822 (GRCm39) V239M possibly damaging Het
Other mutations in Tbx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Tbx18 APN 9 87,587,676 (GRCm39) missense possibly damaging 0.90
IGL00832:Tbx18 APN 9 87,587,714 (GRCm39) missense probably damaging 1.00
IGL01287:Tbx18 APN 9 87,606,384 (GRCm39) missense probably damaging 0.98
IGL01406:Tbx18 APN 9 87,595,596 (GRCm39) missense probably damaging 0.99
IGL01587:Tbx18 APN 9 87,606,461 (GRCm39) missense probably damaging 0.99
IGL01898:Tbx18 APN 9 87,589,912 (GRCm39) missense possibly damaging 0.92
IGL02624:Tbx18 APN 9 87,609,459 (GRCm39) missense probably damaging 1.00
IGL03057:Tbx18 APN 9 87,612,882 (GRCm39) missense probably damaging 0.99
IGL03252:Tbx18 APN 9 87,587,633 (GRCm39) missense probably damaging 1.00
R0126:Tbx18 UTSW 9 87,611,706 (GRCm39) missense possibly damaging 0.50
R0243:Tbx18 UTSW 9 87,597,569 (GRCm39) splice site probably benign
R0374:Tbx18 UTSW 9 87,606,408 (GRCm39) missense probably damaging 0.97
R0666:Tbx18 UTSW 9 87,606,462 (GRCm39) missense probably benign 0.13
R2141:Tbx18 UTSW 9 87,597,706 (GRCm39) missense probably damaging 0.99
R2183:Tbx18 UTSW 9 87,587,789 (GRCm39) missense probably damaging 0.98
R2233:Tbx18 UTSW 9 87,606,403 (GRCm39) missense probably damaging 1.00
R2235:Tbx18 UTSW 9 87,606,403 (GRCm39) missense probably damaging 1.00
R3835:Tbx18 UTSW 9 87,611,689 (GRCm39) missense probably benign
R4214:Tbx18 UTSW 9 87,606,518 (GRCm39) missense probably damaging 1.00
R4606:Tbx18 UTSW 9 87,612,822 (GRCm39) missense possibly damaging 0.84
R4834:Tbx18 UTSW 9 87,609,502 (GRCm39) missense possibly damaging 0.48
R5112:Tbx18 UTSW 9 87,597,740 (GRCm39) missense probably damaging 1.00
R5887:Tbx18 UTSW 9 87,595,566 (GRCm39) missense possibly damaging 0.58
R6628:Tbx18 UTSW 9 87,597,588 (GRCm39) nonsense probably null
R6659:Tbx18 UTSW 9 87,589,864 (GRCm39) missense probably damaging 1.00
R7001:Tbx18 UTSW 9 87,609,457 (GRCm39) missense probably damaging 1.00
R7057:Tbx18 UTSW 9 87,587,317 (GRCm39) missense possibly damaging 0.94
R7167:Tbx18 UTSW 9 87,589,883 (GRCm39) missense probably damaging 1.00
R7368:Tbx18 UTSW 9 87,612,750 (GRCm39) missense probably benign
R8147:Tbx18 UTSW 9 87,606,411 (GRCm39) missense probably damaging 0.97
R8993:Tbx18 UTSW 9 87,612,770 (GRCm39) missense probably benign 0.00
R9263:Tbx18 UTSW 9 87,611,521 (GRCm39) missense probably damaging 0.97
R9291:Tbx18 UTSW 9 87,611,535 (GRCm39) missense probably damaging 1.00
R9396:Tbx18 UTSW 9 87,609,432 (GRCm39) missense probably damaging 1.00
R9420:Tbx18 UTSW 9 87,612,675 (GRCm39) missense probably benign
R9508:Tbx18 UTSW 9 87,587,926 (GRCm39) missense probably damaging 0.96
R9577:Tbx18 UTSW 9 87,611,512 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACACTTGAGCTGGAGCCATG -3'
(R):5'- GCTCTGAGTTGTTAATTCCAAGG -3'

Sequencing Primer
(F):5'- GGAGCCATGGTCTCTGATACAAATAC -3'
(R):5'- GTTAATTCCAAGGAATGCACAGTCC -3'
Posted On 2014-10-15