Incidental Mutation 'R2234:Nphp3'
ID 239933
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Name nephronophthisis 3 (adolescent)
Synonyms 3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission 040235-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2234 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 104002544-104043818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104037376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1052 (R1052H)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774] [ENSMUST00000216593]
AlphaFold Q7TNH6
Predicted Effect probably benign
Transcript: ENSMUST00000035167
AA Change: R1052H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: R1052H

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129819
AA Change: R932H
SMART Domains Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: R932H

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192485
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193642
Predicted Effect probably benign
Transcript: ENSMUST00000194183
AA Change: R111H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558
AA Change: R111H

DomainStartEndE-ValueType
Pfam:TPR_10 1 37 3.4e-5 PFAM
Pfam:TPR_12 1 71 1.8e-14 PFAM
Pfam:TPR_10 38 79 6.5e-8 PFAM
Pfam:TPR_1 39 72 6.8e-4 PFAM
Pfam:TPR_10 81 115 9e-3 PFAM
Pfam:TPR_7 83 118 1.6e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194774
AA Change: R932H
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: R932H

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216593
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Akap8l C T 17: 32,338,803 G37R probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Cd81 T A 7: 143,066,319 N71K probably benign Het
Cemip G T 7: 83,998,562 D103E probably benign Het
Chfr A G 5: 110,170,863 K580E probably damaging Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cpb1 A T 3: 20,275,465 D32E probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
Eml5 A C 12: 98,841,581 D984E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hspa2 A G 12: 76,404,645 T38A possibly damaging Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kalrn C A 16: 34,176,262 probably null Het
Kmt2d T C 15: 98,865,248 D240G probably damaging Het
Lrrc56 T A 7: 141,198,294 D66E probably damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1089 A G 2: 86,733,577 F12L possibly damaging Het
Olfr1219 A G 2: 89,074,248 L281P probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr710 C A 7: 106,944,620 C127F probably damaging Het
Olfr832 A T 9: 18,944,816 H56L probably damaging Het
Pax8 A G 2: 24,443,102 I77T probably damaging Het
Paxbp1 T C 16: 91,034,934 I355M probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Plec A T 15: 76,176,947 I2952N probably damaging Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Ssc5d A G 7: 4,943,850 T1068A probably benign Het
Stambp A G 6: 83,551,978 S362P probably damaging Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tnk1 C T 11: 69,855,191 probably null Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xpnpep1 T G 19: 53,013,461 D118A probably damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
R8882:Nphp3 UTSW 9 104005594 missense possibly damaging 0.77
R9020:Nphp3 UTSW 9 104031951 missense probably benign 0.00
R9132:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9135:Nphp3 UTSW 9 104032015 missense probably damaging 0.99
R9159:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9204:Nphp3 UTSW 9 104042106 missense probably benign
R9226:Nphp3 UTSW 9 104008129 missense probably benign 0.00
R9229:Nphp3 UTSW 9 104036177 missense probably damaging 1.00
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTTAAGAGTCAGAACCACTGTGC -3'
(R):5'- CAGCTGAGCTTTGTAACTGC -3'

Sequencing Primer
(F):5'- GAGTCAGAACCACTGTGCATTATGTC -3'
(R):5'- AGCTGAGCTTTGTAACTGCTCAAC -3'
Posted On 2014-10-15