Mutagenetix > Incidental Mutations

Incidental Mutation 'R2230:Plxnd1'

239982

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

040231-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2230 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 115964144 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1302 (R1302L)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015511
AA Change: R1302L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: R1302L

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131590

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203628

Meta Mutation Damage Score

0.4338

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (62/62)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	T	A	8: 36,512,553	C437S	probably damaging	Het
Adam12	A	T	7: 133,919,618	N280K	probably damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Ankra2	T	C	13: 98,271,138	F199L	probably damaging	Het
Ankrd63	A	G	2: 118,703,365		probably benign	Het
Apoa2	A	G	1: 171,225,771	K53R	probably benign	Het
Atr	A	G	9: 95,920,765	R1827G	probably damaging	Het
Ccdc61	T	C	7: 18,891,107	E502G	probably damaging	Het
Cdon	T	C	9: 35,491,926		probably null	Het
Ctgf	T	A	10: 24,596,473	M138K	possibly damaging	Het
Cyp2c68	T	A	19: 39,699,360	S398C	probably benign	Het
Cyp2e1	T	C	7: 140,764,914	S98P	probably damaging	Het
Dock2	T	A	11: 34,294,323	I1036F	probably damaging	Het
Entpd7	T	C	19: 43,721,816	V304A	probably benign	Het
Ergic3	A	G	2: 156,017,816	T346A	probably damaging	Het
F2	T	C	2: 91,625,757	D553G	probably benign	Het
Fam189a1	G	A	7: 64,759,222	H475Y	probably damaging	Het
Fam227a	T	A	15: 79,615,381	Y591F	possibly damaging	Het
Gal3st1	T	C	11: 3,998,282	I163T	probably benign	Het
Gm10650	A	G	3: 128,039,763		noncoding transcript	Het
Gm21850	G	T	2: 154,058,328	V202L	probably benign	Het
Hdc	T	A	2: 126,594,018	E644D	possibly damaging	Het
Hypk	G	A	2: 121,457,292		probably null	Het
Kif21a	G	A	15: 90,985,362	Q429*	probably null	Het
Mgll	G	A	6: 88,825,732	V318M	possibly damaging	Het
Mrgprb3	T	C	7: 48,643,022	I260M	probably benign	Het
Musk	A	T	4: 58,333,672	I256F	possibly damaging	Het
Myl3	T	C	9: 110,767,911	L113P	probably damaging	Het
Myo5c	A	G	9: 75,273,606	D759G	probably benign	Het
Nkx2-1	G	A	12: 56,533,286	Q290*	probably null	Het
Oaz3	T	C	3: 94,434,539	T130A	probably benign	Het
Olfr140	A	T	2: 90,052,225	F33Y	probably benign	Het
Olfr1406	A	G	1: 173,183,615	I273T	probably benign	Het
Olfr828	A	G	9: 18,815,725	S190P	probably damaging	Het
Olfr891	T	C	9: 38,180,146	T226A	probably benign	Het
Pabpc2	G	A	18: 39,775,070	V463I	probably benign	Het
Piezo2	A	T	18: 63,145,072	C254S	probably damaging	Het
Pnpla7	T	C	2: 25,051,598		probably benign	Het
Ppl	G	A	16: 5,088,981	T1150I	possibly damaging	Het
Prkag2	G	T	5: 24,908,364	A113E	probably benign	Het
Proz	A	G	8: 13,063,356	Y59C	probably damaging	Het
Prr5	T	C	15: 84,702,780	S244P	probably benign	Het
Sec14l5	A	G	16: 5,176,481	T380A	probably damaging	Het
Snw1	A	G	12: 87,452,658	V391A	probably benign	Het
Sp2	C	T	11: 96,955,936	C527Y	probably damaging	Het
Sspo	A	G	6: 48,448,672	I76V	probably damaging	Het
Sspo	C	A	6: 48,500,503	Q5123K	probably benign	Het
Tbc1d21	A	C	9: 58,363,080	N137K	probably damaging	Het
Tek	G	A	4: 94,811,336	C317Y	probably damaging	Het
Tet3	T	C	6: 83,369,471	D1328G	probably damaging	Het
Topbp1	T	A	9: 103,345,848	I1377N	probably damaging	Het
Ttf2	A	G	3: 100,957,944	V544A	probably damaging	Het
Ttn	A	T	2: 76,944,153	F2136L	probably damaging	Het
Ugt2b38	A	G	5: 87,421,668	F267L	probably benign	Het
Usb1	T	G	8: 95,344,046	L200R	probably damaging	Het
Vwa5a	G	A	9: 38,733,878	G420R	probably null	Het
Vwa8	T	C	14: 79,092,403		probably null	Het
Zfp708	A	T	13: 67,070,972	Y229*	probably null	Het
Zzef1	T	A	11: 72,884,416	M1745K	probably damaging	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	unclassified	probably null
R1865:Plxnd1	UTSW	6	115969441	unclassified	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	intron	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATCCGTCATGTCTGTCTGCAG -3'
(R):5'- TCTAAGAGACATCAGGGTTGTCC -3'

Sequencing Primer
(F):5'- TGTCTGCAGCTCCGCAAAG -3'
(R):5'- AGGCTAAGGACACCTGCTC -3'

Posted On

2014-10-15