Incidental Mutation 'R2230:Topbp1'
ID240001
Institutional Source Beutler Lab
Gene Symbol Topbp1
Ensembl Gene ENSMUSG00000032555
Gene Nametopoisomerase (DNA) II binding protein 1
SynonymsD430026L04Rik, 2810429C13Rik, 1110031N14Rik
MMRRC Submission 040231-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2230 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103305215-103350428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103345848 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1377 (I1377N)
Ref Sequence ENSEMBL: ENSMUSP00000035164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035164] [ENSMUST00000185305]
Predicted Effect probably damaging
Transcript: ENSMUST00000035164
AA Change: I1377N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555
AA Change: I1377N

DomainStartEndE-ValueType
BRCT 6 91 3.04e1 SMART
BRCT 103 179 1.51e-13 SMART
BRCT 197 274 4.69e-19 SMART
BRCT 355 433 3.58e-15 SMART
BRCT 553 626 5.57e-3 SMART
BRCT 646 731 1.53e-9 SMART
BRCT 904 983 3.48e-13 SMART
low complexity region 1097 1106 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1213 1218 N/A INTRINSIC
BRCT 1258 1337 2.31e-9 SMART
Blast:BRCT 1387 1472 4e-52 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185305
SMART Domains Protein: ENSMUSP00000140862
Gene: ENSMUSG00000032555

DomainStartEndE-ValueType
Blast:BRCT 30 59 2e-14 BLAST
PDB:3AL3|A 32 59 1e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000185721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190712
Meta Mutation Damage Score 0.2321 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam12 A T 7: 133,919,618 N280K probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Apoa2 A G 1: 171,225,771 K53R probably benign Het
Atr A G 9: 95,920,765 R1827G probably damaging Het
Ccdc61 T C 7: 18,891,107 E502G probably damaging Het
Cdon T C 9: 35,491,926 probably null Het
Ctgf T A 10: 24,596,473 M138K possibly damaging Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dock2 T A 11: 34,294,323 I1036F probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
F2 T C 2: 91,625,757 D553G probably benign Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Gm10650 A G 3: 128,039,763 noncoding transcript Het
Gm21850 G T 2: 154,058,328 V202L probably benign Het
Hdc T A 2: 126,594,018 E644D possibly damaging Het
Hypk G A 2: 121,457,292 probably null Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
Mgll G A 6: 88,825,732 V318M possibly damaging Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Musk A T 4: 58,333,672 I256F possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Myo5c A G 9: 75,273,606 D759G probably benign Het
Nkx2-1 G A 12: 56,533,286 Q290* probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Olfr828 A G 9: 18,815,725 S190P probably damaging Het
Olfr891 T C 9: 38,180,146 T226A probably benign Het
Pabpc2 G A 18: 39,775,070 V463I probably benign Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plxnd1 C A 6: 115,964,144 R1302L probably damaging Het
Pnpla7 T C 2: 25,051,598 probably benign Het
Ppl G A 16: 5,088,981 T1150I possibly damaging Het
Prkag2 G T 5: 24,908,364 A113E probably benign Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sec14l5 A G 16: 5,176,481 T380A probably damaging Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
Sspo C A 6: 48,500,503 Q5123K probably benign Het
Tbc1d21 A C 9: 58,363,080 N137K probably damaging Het
Tek G A 4: 94,811,336 C317Y probably damaging Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Ttf2 A G 3: 100,957,944 V544A probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Ugt2b38 A G 5: 87,421,668 F267L probably benign Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Vwa8 T C 14: 79,092,403 probably null Het
Zfp708 A T 13: 67,070,972 Y229* probably null Het
Zzef1 T A 11: 72,884,416 M1745K probably damaging Het
Other mutations in Topbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Topbp1 APN 9 103344943 missense probably benign
IGL01524:Topbp1 APN 9 103311645 missense possibly damaging 0.92
IGL02335:Topbp1 APN 9 103328523 missense probably damaging 1.00
IGL02441:Topbp1 APN 9 103320239 missense possibly damaging 0.49
IGL02943:Topbp1 APN 9 103328440 missense probably benign 0.00
IGL02953:Topbp1 APN 9 103328435 missense probably benign 0.26
IGL03040:Topbp1 APN 9 103328667 missense possibly damaging 0.51
PIT4377001:Topbp1 UTSW 9 103309889 missense possibly damaging 0.90
R0044:Topbp1 UTSW 9 103325773 missense possibly damaging 0.94
R0344:Topbp1 UTSW 9 103328687 missense probably damaging 0.99
R0344:Topbp1 UTSW 9 103308733 splice site probably benign
R0591:Topbp1 UTSW 9 103349838 missense probably benign 0.01
R0666:Topbp1 UTSW 9 103308812 missense probably benign
R0785:Topbp1 UTSW 9 103315090 missense probably damaging 1.00
R0906:Topbp1 UTSW 9 103328593 missense probably benign 0.00
R1352:Topbp1 UTSW 9 103347008 missense probably benign
R1745:Topbp1 UTSW 9 103308845 missense probably benign 0.36
R2104:Topbp1 UTSW 9 103317982 splice site probably benign
R2166:Topbp1 UTSW 9 103312929 splice site probably null
R2967:Topbp1 UTSW 9 103342140 missense probably benign 0.01
R3845:Topbp1 UTSW 9 103309923 missense possibly damaging 0.87
R4089:Topbp1 UTSW 9 103324501 critical splice donor site probably null
R4110:Topbp1 UTSW 9 103309959 missense probably damaging 0.98
R4454:Topbp1 UTSW 9 103344871 missense probably damaging 1.00
R4521:Topbp1 UTSW 9 103334202 intron probably benign
R4745:Topbp1 UTSW 9 103323571 missense probably damaging 1.00
R4923:Topbp1 UTSW 9 103312836 missense probably benign 0.00
R4934:Topbp1 UTSW 9 103328369 unclassified probably benign
R4963:Topbp1 UTSW 9 103320605 missense probably benign 0.04
R5199:Topbp1 UTSW 9 103346672 unclassified probably benign
R5461:Topbp1 UTSW 9 103315196 missense probably benign 0.00
R5517:Topbp1 UTSW 9 103336114 missense probably benign 0.03
R5563:Topbp1 UTSW 9 103311513 missense possibly damaging 0.46
R5564:Topbp1 UTSW 9 103334078 missense probably damaging 1.00
R5683:Topbp1 UTSW 9 103312804 missense possibly damaging 0.93
R5774:Topbp1 UTSW 9 103328499 missense probably benign 0.06
R5785:Topbp1 UTSW 9 103323528 missense probably benign 0.00
R6029:Topbp1 UTSW 9 103344953 missense probably benign 0.00
R6077:Topbp1 UTSW 9 103332990 missense probably damaging 1.00
R6122:Topbp1 UTSW 9 103346961 missense probably benign 0.06
R6133:Topbp1 UTSW 9 103311764 splice site probably null
R6213:Topbp1 UTSW 9 103332751 missense probably benign 0.12
R6773:Topbp1 UTSW 9 103343692 missense possibly damaging 0.90
R6922:Topbp1 UTSW 9 103335846 missense probably damaging 1.00
R6938:Topbp1 UTSW 9 103328554 missense probably damaging 1.00
R7305:Topbp1 UTSW 9 103328637 missense probably damaging 1.00
R7419:Topbp1 UTSW 9 103323344 missense probably benign
R7517:Topbp1 UTSW 9 103332733 missense possibly damaging 0.82
R7605:Topbp1 UTSW 9 103332706 missense probably benign 0.41
R7701:Topbp1 UTSW 9 103332985 missense probably damaging 0.96
R7741:Topbp1 UTSW 9 103320557 missense probably damaging 0.97
R8115:Topbp1 UTSW 9 103320541 missense probably benign
R8177:Topbp1 UTSW 9 103320541 missense probably benign 0.01
R8269:Topbp1 UTSW 9 103328593 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCCAGATACCCATGCTTAGTTAG -3'
(R):5'- TGATGCTCTACCCTGAAAAGAC -3'

Sequencing Primer
(F):5'- GAACCCACAAGTTCACTG -3'
(R):5'- GGCAGGATTTCTACATAGCCTCAG -3'
Posted On2014-10-15