Incidental Mutation 'R2230:Snw1'
ID240009
Institutional Source Beutler Lab
Gene Symbol Snw1
Ensembl Gene ENSMUSG00000021039
Gene NameSNW domain containing 1
SynonymsSkiip, SKIP, NCoA-62, 2310008B08Rik, SNW1
MMRRC Submission 040231-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2230 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87449075-87472274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87452658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 391 (V391A)
Ref Sequence ENSEMBL: ENSMUSP00000021428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021428] [ENSMUST00000077462] [ENSMUST00000160488] [ENSMUST00000161023]
Predicted Effect probably benign
Transcript: ENSMUST00000021428
AA Change: V391A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021428
Gene: ENSMUSG00000021039
AA Change: V391A

DomainStartEndE-ValueType
Pfam:SKIP_SNW 175 335 2e-78 PFAM
low complexity region 524 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077462
SMART Domains Protein: ENSMUSP00000076673
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 18 82 1.08e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160488
SMART Domains Protein: ENSMUSP00000124174
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 20 92 2.41e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160880
SMART Domains Protein: ENSMUSP00000125727
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
Blast:RRM 15 47 6e-17 BLAST
SCOP:d1u2fa_ 17 59 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161023
SMART Domains Protein: ENSMUSP00000125341
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 20 92 1.73e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222579
Meta Mutation Damage Score 0.0985 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNW gene family, encodes a coactivator that enhances transcription from some Pol II promoters. This coactivator can bind to the ligand-binding domain of the vitamin D receptor and to retinoid receptors to enhance vitamin D-, retinoic acid-, estrogen-, and glucocorticoid-mediated gene expression. It can also function as a splicing factor by interacting with poly(A)-binding protein 2 to directly control the expression of muscle-specific genes at the transcriptional level. Finally, the protein may be involved in oncogenesis since it interacts with a region of SKI oncoproteins that is required for transforming activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam12 A T 7: 133,919,618 N280K probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Apoa2 A G 1: 171,225,771 K53R probably benign Het
Atr A G 9: 95,920,765 R1827G probably damaging Het
Ccdc61 T C 7: 18,891,107 E502G probably damaging Het
Cdon T C 9: 35,491,926 probably null Het
Ctgf T A 10: 24,596,473 M138K possibly damaging Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dock2 T A 11: 34,294,323 I1036F probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
F2 T C 2: 91,625,757 D553G probably benign Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Gm10650 A G 3: 128,039,763 noncoding transcript Het
Gm21850 G T 2: 154,058,328 V202L probably benign Het
Hdc T A 2: 126,594,018 E644D possibly damaging Het
Hypk G A 2: 121,457,292 probably null Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
Mgll G A 6: 88,825,732 V318M possibly damaging Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Musk A T 4: 58,333,672 I256F possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Myo5c A G 9: 75,273,606 D759G probably benign Het
Nkx2-1 G A 12: 56,533,286 Q290* probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Olfr828 A G 9: 18,815,725 S190P probably damaging Het
Olfr891 T C 9: 38,180,146 T226A probably benign Het
Pabpc2 G A 18: 39,775,070 V463I probably benign Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plxnd1 C A 6: 115,964,144 R1302L probably damaging Het
Pnpla7 T C 2: 25,051,598 probably benign Het
Ppl G A 16: 5,088,981 T1150I possibly damaging Het
Prkag2 G T 5: 24,908,364 A113E probably benign Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sec14l5 A G 16: 5,176,481 T380A probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
Sspo C A 6: 48,500,503 Q5123K probably benign Het
Tbc1d21 A C 9: 58,363,080 N137K probably damaging Het
Tek G A 4: 94,811,336 C317Y probably damaging Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Topbp1 T A 9: 103,345,848 I1377N probably damaging Het
Ttf2 A G 3: 100,957,944 V544A probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Ugt2b38 A G 5: 87,421,668 F267L probably benign Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Vwa8 T C 14: 79,092,403 probably null Het
Zfp708 A T 13: 67,070,972 Y229* probably null Het
Zzef1 T A 11: 72,884,416 M1745K probably damaging Het
Other mutations in Snw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Snw1 APN 12 87452580 critical splice donor site probably null
IGL00559:Snw1 APN 12 87468731 missense probably damaging 0.98
IGL00561:Snw1 APN 12 87450804 critical splice donor site probably null
IGL01019:Snw1 APN 12 87450941 missense probably benign 0.24
IGL01304:Snw1 APN 12 87453915 missense possibly damaging 0.71
IGL01918:Snw1 APN 12 87455668 missense probably benign 0.14
IGL03170:Snw1 APN 12 87472252 missense probably benign 0.00
R0149:Snw1 UTSW 12 87461917 missense possibly damaging 0.51
R1760:Snw1 UTSW 12 87464689 missense probably benign 0.06
R1935:Snw1 UTSW 12 87459477 missense probably damaging 1.00
R2130:Snw1 UTSW 12 87452703 unclassified probably benign
R2496:Snw1 UTSW 12 87450819 missense probably benign
R4907:Snw1 UTSW 12 87459489 missense probably benign 0.19
R4926:Snw1 UTSW 12 87452658 missense probably benign 0.00
R5138:Snw1 UTSW 12 87460435 missense probably benign 0.00
R5447:Snw1 UTSW 12 87455715 missense probably benign 0.19
R6239:Snw1 UTSW 12 87464628 missense probably damaging 1.00
R6552:Snw1 UTSW 12 87459419 critical splice donor site probably null
R6747:Snw1 UTSW 12 87464710 missense probably damaging 1.00
R7230:Snw1 UTSW 12 87464554 missense probably damaging 1.00
R7242:Snw1 UTSW 12 87468645 missense possibly damaging 0.94
R8184:Snw1 UTSW 12 87453903 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATCCCTGGGACGAGCTAAGAC -3'
(R):5'- TGTGACTGTGTATCATCAGACC -3'

Sequencing Primer
(F):5'- TGGGACGAGCTAAGACTACACTTAC -3'
(R):5'- TGTGTATCATCAGACCATATATGTCC -3'
Posted On2014-10-15