Mutagenetix > Incidental Mutations

Incidental Mutation 'R2230:Vwa8'

240012

Institutional Source

Beutler Lab

Gene Symbol

Vwa8

Ensembl Gene

ENSMUSG00000058997

Gene Name

von Willebrand factor A domain containing 8

Synonyms

4932416F07Rik, 1300010F03Rik

MMRRC Submission

040231-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2230 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78849052-79202310 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 79092403 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000048925 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040990]

Predicted Effect

probably null
Transcript: ENSMUST00000040990

SMART Domains

Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	20	33	N/A	INTRINSIC
Pfam:AAA_5	104	260	6.3e-44	PFAM
AAA	438	613	4.69e-2	SMART
AAA	772	904	1.26e-1	SMART
low complexity region	1213	1221	N/A	INTRINSIC
low complexity region	1565	1586	N/A	INTRINSIC
VWA	1712	1901	2.71e-10	SMART

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	T	A	8: 36,512,553	C437S	probably damaging	Het
Adam12	A	T	7: 133,919,618	N280K	probably damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Ankra2	T	C	13: 98,271,138	F199L	probably damaging	Het
Ankrd63	A	G	2: 118,703,365		probably benign	Het
Apoa2	A	G	1: 171,225,771	K53R	probably benign	Het
Atr	A	G	9: 95,920,765	R1827G	probably damaging	Het
Ccdc61	T	C	7: 18,891,107	E502G	probably damaging	Het
Cdon	T	C	9: 35,491,926		probably null	Het
Ctgf	T	A	10: 24,596,473	M138K	possibly damaging	Het
Cyp2c68	T	A	19: 39,699,360	S398C	probably benign	Het
Cyp2e1	T	C	7: 140,764,914	S98P	probably damaging	Het
Dock2	T	A	11: 34,294,323	I1036F	probably damaging	Het
Entpd7	T	C	19: 43,721,816	V304A	probably benign	Het
Ergic3	A	G	2: 156,017,816	T346A	probably damaging	Het
F2	T	C	2: 91,625,757	D553G	probably benign	Het
Fam189a1	G	A	7: 64,759,222	H475Y	probably damaging	Het
Fam227a	T	A	15: 79,615,381	Y591F	possibly damaging	Het
Gal3st1	T	C	11: 3,998,282	I163T	probably benign	Het
Gm10650	A	G	3: 128,039,763		noncoding transcript	Het
Gm21850	G	T	2: 154,058,328	V202L	probably benign	Het
Hdc	T	A	2: 126,594,018	E644D	possibly damaging	Het
Hypk	G	A	2: 121,457,292		probably null	Het
Kif21a	G	A	15: 90,985,362	Q429*	probably null	Het
Mgll	G	A	6: 88,825,732	V318M	possibly damaging	Het
Mrgprb3	T	C	7: 48,643,022	I260M	probably benign	Het
Musk	A	T	4: 58,333,672	I256F	possibly damaging	Het
Myl3	T	C	9: 110,767,911	L113P	probably damaging	Het
Myo5c	A	G	9: 75,273,606	D759G	probably benign	Het
Nkx2-1	G	A	12: 56,533,286	Q290*	probably null	Het
Oaz3	T	C	3: 94,434,539	T130A	probably benign	Het
Olfr140	A	T	2: 90,052,225	F33Y	probably benign	Het
Olfr1406	A	G	1: 173,183,615	I273T	probably benign	Het
Olfr828	A	G	9: 18,815,725	S190P	probably damaging	Het
Olfr891	T	C	9: 38,180,146	T226A	probably benign	Het
Pabpc2	G	A	18: 39,775,070	V463I	probably benign	Het
Piezo2	A	T	18: 63,145,072	C254S	probably damaging	Het
Plxnd1	C	A	6: 115,964,144	R1302L	probably damaging	Het
Pnpla7	T	C	2: 25,051,598		probably benign	Het
Ppl	G	A	16: 5,088,981	T1150I	possibly damaging	Het
Prkag2	G	T	5: 24,908,364	A113E	probably benign	Het
Proz	A	G	8: 13,063,356	Y59C	probably damaging	Het
Prr5	T	C	15: 84,702,780	S244P	probably benign	Het
Sec14l5	A	G	16: 5,176,481	T380A	probably damaging	Het
Snw1	A	G	12: 87,452,658	V391A	probably benign	Het
Sp2	C	T	11: 96,955,936	C527Y	probably damaging	Het
Sspo	A	G	6: 48,448,672	I76V	probably damaging	Het
Sspo	C	A	6: 48,500,503	Q5123K	probably benign	Het
Tbc1d21	A	C	9: 58,363,080	N137K	probably damaging	Het
Tek	G	A	4: 94,811,336	C317Y	probably damaging	Het
Tet3	T	C	6: 83,369,471	D1328G	probably damaging	Het
Topbp1	T	A	9: 103,345,848	I1377N	probably damaging	Het
Ttf2	A	G	3: 100,957,944	V544A	probably damaging	Het
Ttn	A	T	2: 76,944,153	F2136L	probably damaging	Het
Ugt2b38	A	G	5: 87,421,668	F267L	probably benign	Het
Usb1	T	G	8: 95,344,046	L200R	probably damaging	Het
Vwa5a	G	A	9: 38,733,878	G420R	probably null	Het
Zfp708	A	T	13: 67,070,972	Y229*	probably null	Het
Zzef1	T	A	11: 72,884,416	M1745K	probably damaging	Het

Other mutations in Vwa8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Vwa8	APN	14	79038195	missense	probably damaging	1.00
IGL01087:Vwa8	APN	14	78935229	missense	probably benign	0.16
IGL01137:Vwa8	APN	14	79103647	missense	probably damaging	1.00
IGL01359:Vwa8	APN	14	79064913	nonsense	probably null
IGL01449:Vwa8	APN	14	79182988	nonsense	probably null
IGL01604:Vwa8	APN	14	79180804	missense	possibly damaging	0.82
IGL01636:Vwa8	APN	14	79198354	missense	possibly damaging	0.68
IGL01815:Vwa8	APN	14	79198277	missense	possibly damaging	0.92
IGL02024:Vwa8	APN	14	79094284	missense	possibly damaging	0.91
IGL02033:Vwa8	APN	14	78984209	missense	possibly damaging	0.89
IGL02154:Vwa8	APN	14	78849293	missense	possibly damaging	0.53
IGL02286:Vwa8	APN	14	78947273	critical splice donor site	probably null
IGL02393:Vwa8	APN	14	79182977	missense	probably damaging	1.00
IGL02430:Vwa8	APN	14	78934645	critical splice donor site	probably null
IGL02476:Vwa8	APN	14	78925341	missense	possibly damaging	0.62
IGL02612:Vwa8	APN	14	79183112	missense	probably benign	0.01
IGL02678:Vwa8	APN	14	78984200	missense	probably damaging	0.99
IGL02797:Vwa8	APN	14	78925262	missense	probably benign	0.29
IGL02806:Vwa8	APN	14	79157088	missense	probably benign	0.35
IGL02811:Vwa8	APN	14	78994459	missense	probably benign	0.21
IGL02892:Vwa8	APN	14	79103700	splice site	probably benign
IGL03024:Vwa8	APN	14	78995098	missense	probably benign	0.03
IGL03075:Vwa8	APN	14	78933756	missense	probably damaging	0.99
IGL03090:Vwa8	APN	14	78934601	missense	possibly damaging	0.92
IGL03124:Vwa8	APN	14	79058815	splice site	probably benign
IGL03181:Vwa8	APN	14	79009250	missense	probably benign	0.01
IGL03296:Vwa8	APN	14	79183100	missense	probably damaging	0.98
IGL03376:Vwa8	APN	14	79183134	splice site	probably null
R6812_Vwa8_870	UTSW	14	79197419	missense	probably damaging	0.99
IGL03052:Vwa8	UTSW	14	79064921	missense	probably benign	0.02
PIT4468001:Vwa8	UTSW	14	79183061	missense	probably damaging	1.00
R0049:Vwa8	UTSW	14	79093739	missense	probably benign	0.21
R0063:Vwa8	UTSW	14	79164216	splice site	probably benign
R0063:Vwa8	UTSW	14	79164216	splice site	probably benign
R0081:Vwa8	UTSW	14	79082782	missense	probably benign	0.02
R0305:Vwa8	UTSW	14	79009273	missense	probably damaging	1.00
R0433:Vwa8	UTSW	14	79062676	missense	probably damaging	1.00
R0514:Vwa8	UTSW	14	78947189	missense	probably benign
R0602:Vwa8	UTSW	14	79020620	missense	probably benign	0.00
R0615:Vwa8	UTSW	14	78908150	missense	probably benign
R0791:Vwa8	UTSW	14	78994576	splice site	probably benign
R1028:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1037:Vwa8	UTSW	14	79086654	nonsense	probably null
R1404:Vwa8	UTSW	14	79026031	missense	probably damaging	1.00
R1404:Vwa8	UTSW	14	79026031	missense	probably damaging	1.00
R1412:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1421:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1467:Vwa8	UTSW	14	79103694	nonsense	probably null
R1467:Vwa8	UTSW	14	79103694	nonsense	probably null
R1539:Vwa8	UTSW	14	79062562	missense	probably benign	0.00
R1556:Vwa8	UTSW	14	79086681	missense	probably benign
R1589:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1590:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1591:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1645:Vwa8	UTSW	14	79182987	missense	probably damaging	1.00
R1673:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1688:Vwa8	UTSW	14	79201103	missense	possibly damaging	0.72
R1764:Vwa8	UTSW	14	78908195	missense	probably damaging	1.00
R1830:Vwa8	UTSW	14	79081136	missense	probably benign	0.04
R1926:Vwa8	UTSW	14	79020635	missense	probably benign	0.00
R1959:Vwa8	UTSW	14	78982360	missense	possibly damaging	0.95
R1971:Vwa8	UTSW	14	78925254	splice site	probably benign
R2078:Vwa8	UTSW	14	78908157	missense	probably damaging	1.00
R2103:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R2281:Vwa8	UTSW	14	79064996	missense	possibly damaging	0.91
R2313:Vwa8	UTSW	14	78912218	missense	probably damaging	0.98
R2847:Vwa8	UTSW	14	78947142	missense	probably benign	0.00
R2848:Vwa8	UTSW	14	78947142	missense	probably benign	0.00
R2894:Vwa8	UTSW	14	79038138	missense	probably damaging	1.00
R2991:Vwa8	UTSW	14	78995149	missense	probably benign	0.00
R3077:Vwa8	UTSW	14	79098342	missense	probably benign	0.03
R3405:Vwa8	UTSW	14	79164220	splice site	probably benign
R3406:Vwa8	UTSW	14	79164220	splice site	probably benign
R3708:Vwa8	UTSW	14	79062696	splice site	probably benign
R3779:Vwa8	UTSW	14	79102322	splice site	probably benign
R3799:Vwa8	UTSW	14	79064896	missense	probably damaging	0.99
R4230:Vwa8	UTSW	14	79082852	missense	probably benign	0.00
R4425:Vwa8	UTSW	14	79082806	missense	probably benign	0.00
R4478:Vwa8	UTSW	14	78868801	missense	probably benign	0.00
R4627:Vwa8	UTSW	14	79103697	critical splice donor site	probably null
R4835:Vwa8	UTSW	14	78934613	missense	probably benign	0.11
R4868:Vwa8	UTSW	14	79183082	missense	probably damaging	1.00
R4988:Vwa8	UTSW	14	79198283	missense	probably benign	0.05
R5137:Vwa8	UTSW	14	79064902	missense	probably damaging	1.00
R5156:Vwa8	UTSW	14	78984226	missense	probably benign	0.00
R5658:Vwa8	UTSW	14	78982398	critical splice donor site	probably null
R5841:Vwa8	UTSW	14	78994518	missense	probably benign
R6057:Vwa8	UTSW	14	79082873	missense	probably benign	0.21
R6244:Vwa8	UTSW	14	79086662	missense	probably benign
R6264:Vwa8	UTSW	14	79086812	missense	possibly damaging	0.64
R6290:Vwa8	UTSW	14	79094332	splice site	probably null
R6332:Vwa8	UTSW	14	79197464	missense	probably benign
R6395:Vwa8	UTSW	14	79093744	missense	probably benign	0.02
R6472:Vwa8	UTSW	14	79009170	missense	possibly damaging	0.71
R6497:Vwa8	UTSW	14	79096401	missense	probably benign	0.00
R6527:Vwa8	UTSW	14	78947213	missense	possibly damaging	0.73
R6552:Vwa8	UTSW	14	79198222	missense	possibly damaging	0.80
R6812:Vwa8	UTSW	14	79197419	missense	probably damaging	0.99
R6994:Vwa8	UTSW	14	78908156	missense	possibly damaging	0.90
R7040:Vwa8	UTSW	14	78912205	missense	probably damaging	1.00
R7357:Vwa8	UTSW	14	79038201	missense	probably null	1.00
R7363:Vwa8	UTSW	14	79018707	missense	probably benign	0.05
R7381:Vwa8	UTSW	14	79095685	missense	probably benign	0.00
R7406:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7408:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7409:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7410:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7483:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7484:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7491:Vwa8	UTSW	14	79082814	missense	probably benign	0.24
R7500:Vwa8	UTSW	14	78925246	splice site	probably null
R7514:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7582:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7584:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7585:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7647:Vwa8	UTSW	14	78935229	missense	probably damaging	0.99
R7685:Vwa8	UTSW	14	79098300	missense	probably benign
R7703:Vwa8	UTSW	14	79026073	missense	probably damaging	1.00
R7730:Vwa8	UTSW	14	78995149	missense	probably benign	0.00
R7775:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7778:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7824:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7885:Vwa8	UTSW	14	79020649	missense	probably benign	0.00
R7902:Vwa8	UTSW	14	79092291	missense	probably benign	0.00
R8262:Vwa8	UTSW	14	78933832	critical splice donor site	probably null
R8458:Vwa8	UTSW	14	79064892	missense	probably damaging	1.00
R8495:Vwa8	UTSW	14	78937177	nonsense	probably null
R8557:Vwa8	UTSW	14	79009209	missense	probably damaging	1.00
Z1088:Vwa8	UTSW	14	78982246	missense	probably benign	0.38
Z1177:Vwa8	UTSW	14	79058692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGTTCCTAGTCACTGCTG -3'
(R):5'- TATGCTGGATACTAAAGGAACCTCC -3'

Sequencing Primer
(F):5'- CAGGTTCCTAGTCACTGCTGTTTTTG -3'
(R):5'- GGAACCTCCTGCTATTTAACGTAC -3'

Posted On

2014-10-15