Incidental Mutation 'R2230:Sec14l5'
ID240017
Institutional Source Beutler Lab
Gene Symbol Sec14l5
Ensembl Gene ENSMUSG00000091712
Gene NameSEC14-like lipid binding 5
Synonyms
MMRRC Submission 040231-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2230 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5147109-5187271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5176481 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 380 (T380A)
Ref Sequence ENSEMBL: ENSMUSP00000155164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165810] [ENSMUST00000230616]
Predicted Effect probably damaging
Transcript: ENSMUST00000165810
AA Change: T380A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128063
Gene: ENSMUSG00000091712
AA Change: T380A

DomainStartEndE-ValueType
Pfam:PRELI 17 173 4.2e-52 PFAM
CRAL_TRIO_N 263 288 1.05e-4 SMART
SEC14 306 479 1.59e-58 SMART
low complexity region 496 510 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000230616
AA Change: T380A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam12 A T 7: 133,919,618 N280K probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Apoa2 A G 1: 171,225,771 K53R probably benign Het
Atr A G 9: 95,920,765 R1827G probably damaging Het
Ccdc61 T C 7: 18,891,107 E502G probably damaging Het
Cdon T C 9: 35,491,926 probably null Het
Ctgf T A 10: 24,596,473 M138K possibly damaging Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dock2 T A 11: 34,294,323 I1036F probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
F2 T C 2: 91,625,757 D553G probably benign Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Gm10650 A G 3: 128,039,763 noncoding transcript Het
Gm21850 G T 2: 154,058,328 V202L probably benign Het
Hdc T A 2: 126,594,018 E644D possibly damaging Het
Hypk G A 2: 121,457,292 probably null Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
Mgll G A 6: 88,825,732 V318M possibly damaging Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Musk A T 4: 58,333,672 I256F possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Myo5c A G 9: 75,273,606 D759G probably benign Het
Nkx2-1 G A 12: 56,533,286 Q290* probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Olfr828 A G 9: 18,815,725 S190P probably damaging Het
Olfr891 T C 9: 38,180,146 T226A probably benign Het
Pabpc2 G A 18: 39,775,070 V463I probably benign Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plxnd1 C A 6: 115,964,144 R1302L probably damaging Het
Pnpla7 T C 2: 25,051,598 probably benign Het
Ppl G A 16: 5,088,981 T1150I possibly damaging Het
Prkag2 G T 5: 24,908,364 A113E probably benign Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
Sspo C A 6: 48,500,503 Q5123K probably benign Het
Tbc1d21 A C 9: 58,363,080 N137K probably damaging Het
Tek G A 4: 94,811,336 C317Y probably damaging Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Topbp1 T A 9: 103,345,848 I1377N probably damaging Het
Ttf2 A G 3: 100,957,944 V544A probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Ugt2b38 A G 5: 87,421,668 F267L probably benign Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Vwa8 T C 14: 79,092,403 probably null Het
Zfp708 A T 13: 67,070,972 Y229* probably null Het
Zzef1 T A 11: 72,884,416 M1745K probably damaging Het
Other mutations in Sec14l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Sec14l5 APN 16 5178630 critical splice donor site probably null
R0226:Sec14l5 UTSW 16 5180303 missense probably benign 0.18
R0333:Sec14l5 UTSW 16 5167066 missense probably damaging 1.00
R0370:Sec14l5 UTSW 16 5180706 missense probably damaging 1.00
R0581:Sec14l5 UTSW 16 5178485 splice site probably null
R2109:Sec14l5 UTSW 16 5167104 nonsense probably null
R2944:Sec14l5 UTSW 16 5180833 missense probably benign 0.05
R3001:Sec14l5 UTSW 16 5171882 missense probably damaging 1.00
R3002:Sec14l5 UTSW 16 5171882 missense probably damaging 1.00
R3409:Sec14l5 UTSW 16 5165654 splice site probably null
R3432:Sec14l5 UTSW 16 5178599 missense possibly damaging 0.55
R3913:Sec14l5 UTSW 16 5147856 splice site probably benign
R4941:Sec14l5 UTSW 16 5176500 missense probably damaging 1.00
R5468:Sec14l5 UTSW 16 5167140 splice site probably null
R5474:Sec14l5 UTSW 16 5178518 missense possibly damaging 0.74
R5871:Sec14l5 UTSW 16 5168853 missense probably benign 0.00
R6226:Sec14l5 UTSW 16 5176565 missense probably damaging 0.99
R6315:Sec14l5 UTSW 16 5180277 missense possibly damaging 0.81
R6333:Sec14l5 UTSW 16 5167044 missense probably benign 0.00
R6360:Sec14l5 UTSW 16 5172995 missense probably damaging 0.99
R7426:Sec14l5 UTSW 16 5180875 missense probably damaging 1.00
X0064:Sec14l5 UTSW 16 5176102 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACGAGACAATTTGGGCGTC -3'
(R):5'- AAGATTCACCCTTTATGTGGCCC -3'

Sequencing Primer
(F):5'- CATCAGGCAAGAACCCGAGTTG -3'
(R):5'- ATGTGGCCCCCTTCTGG -3'
Posted On2014-10-15