Incidental Mutation 'R2230:Piezo2'
ID 240020
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 040231-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2230 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63145072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 254 (C254S)
Ref Sequence ENSEMBL: ENSMUSP00000138758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046860
AA Change: C254S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: C254S

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047480
AA Change: C254S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: C254S

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000182166
AA Change: C146S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182177
Predicted Effect probably damaging
Transcript: ENSMUST00000182233
AA Change: C22S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: C22S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183217
AA Change: C254S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: C254S

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Meta Mutation Damage Score 0.3896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam12 A T 7: 133,919,618 N280K probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Apoa2 A G 1: 171,225,771 K53R probably benign Het
Atr A G 9: 95,920,765 R1827G probably damaging Het
Ccdc61 T C 7: 18,891,107 E502G probably damaging Het
Cdon T C 9: 35,491,926 probably null Het
Ctgf T A 10: 24,596,473 M138K possibly damaging Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dock2 T A 11: 34,294,323 I1036F probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
F2 T C 2: 91,625,757 D553G probably benign Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Gm10650 A G 3: 128,039,763 noncoding transcript Het
Gm21850 G T 2: 154,058,328 V202L probably benign Het
Hdc T A 2: 126,594,018 E644D possibly damaging Het
Hypk G A 2: 121,457,292 probably null Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
Mgll G A 6: 88,825,732 V318M possibly damaging Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Musk A T 4: 58,333,672 I256F possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Myo5c A G 9: 75,273,606 D759G probably benign Het
Nkx2-1 G A 12: 56,533,286 Q290* probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Olfr828 A G 9: 18,815,725 S190P probably damaging Het
Olfr891 T C 9: 38,180,146 T226A probably benign Het
Pabpc2 G A 18: 39,775,070 V463I probably benign Het
Plxnd1 C A 6: 115,964,144 R1302L probably damaging Het
Pnpla7 T C 2: 25,051,598 probably benign Het
Ppl G A 16: 5,088,981 T1150I possibly damaging Het
Prkag2 G T 5: 24,908,364 A113E probably benign Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sec14l5 A G 16: 5,176,481 T380A probably damaging Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo C A 6: 48,500,503 Q5123K probably benign Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
Tbc1d21 A C 9: 58,363,080 N137K probably damaging Het
Tek G A 4: 94,811,336 C317Y probably damaging Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Topbp1 T A 9: 103,345,848 I1377N probably damaging Het
Ttf2 A G 3: 100,957,944 V544A probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Ugt2b38 A G 5: 87,421,668 F267L probably benign Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Vwa8 T C 14: 79,092,403 probably null Het
Zfp708 A T 13: 67,070,972 Y229* probably null Het
Zzef1 T A 11: 72,884,416 M1745K probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,117,699 (GRCm38) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,022,460 (GRCm38) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,070,030 (GRCm38) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,124,614 (GRCm38) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,030,392 (GRCm38) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,182,833 (GRCm38) splice site probably benign
IGL01674:Piezo2 APN 18 63,027,559 (GRCm38) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,083,170 (GRCm38) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,042,788 (GRCm38) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,092,844 (GRCm38) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,020,634 (GRCm38) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,146,844 (GRCm38) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,072,862 (GRCm38) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,032,924 (GRCm38) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,024,475 (GRCm38) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,074,659 (GRCm38) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,064,785 (GRCm38) splice site probably benign
IGL03011:Piezo2 APN 18 63,124,660 (GRCm38) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,070,075 (GRCm38) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,030,272 (GRCm38) splice site probably null
IGL03129:Piezo2 APN 18 63,114,972 (GRCm38) missense probably benign
IGL03143:Piezo2 APN 18 63,108,076 (GRCm38) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,011,598 (GRCm38) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,124,606 (GRCm38) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,053,062 (GRCm38) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,041,720 (GRCm38) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,011,538 (GRCm38) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,021,308 (GRCm38) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,027,704 (GRCm38) missense probably damaging 1.00
Piccolo UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
sopranino UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
woodwind UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,386,200 (GRCm38) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,024,469 (GRCm38) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,102,084 (GRCm38) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,024,491 (GRCm38) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,029,061 (GRCm38) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,102,174 (GRCm38) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,024,451 (GRCm38) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,027,544 (GRCm38) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,022,481 (GRCm38) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,022,426 (GRCm38) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,019,258 (GRCm38) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,041,723 (GRCm38) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,083,235 (GRCm38) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,015,802 (GRCm38) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,086,753 (GRCm38) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,021,254 (GRCm38) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,083,131 (GRCm38) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,144,919 (GRCm38) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,082,915 (GRCm38) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,117,672 (GRCm38) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,021,173 (GRCm38) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,106,284 (GRCm38) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,108,087 (GRCm38) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,032,840 (GRCm38) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,019,344 (GRCm38) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,113,960 (GRCm38) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,078,840 (GRCm38) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,078,781 (GRCm38) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,144,926 (GRCm38) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,059,744 (GRCm38) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,118,935 (GRCm38) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,081,734 (GRCm38) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,117,720 (GRCm38) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,114,041 (GRCm38) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,106,274 (GRCm38) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,022,525 (GRCm38) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,245,624 (GRCm38) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,053,035 (GRCm38) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,146,843 (GRCm38) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,024,435 (GRCm38) nonsense probably null
R3016:Piezo2 UTSW 18 63,042,832 (GRCm38) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,081,793 (GRCm38) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,050,604 (GRCm38) missense probably benign
R4181:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,084,840 (GRCm38) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,102,099 (GRCm38) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,114,063 (GRCm38) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,072,880 (GRCm38) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,086,628 (GRCm38) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,069,963 (GRCm38) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,144,954 (GRCm38) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,078,791 (GRCm38) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,157,262 (GRCm38) missense probably benign
R4961:Piezo2 UTSW 18 63,052,961 (GRCm38) splice site probably null
R4968:Piezo2 UTSW 18 63,144,971 (GRCm38) nonsense probably null
R4973:Piezo2 UTSW 18 63,074,680 (GRCm38) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,083,113 (GRCm38) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,024,536 (GRCm38) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,074,620 (GRCm38) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,030,409 (GRCm38) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,032,929 (GRCm38) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,064,731 (GRCm38) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,084,740 (GRCm38) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,145,105 (GRCm38) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,027,864 (GRCm38) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,011,721 (GRCm38) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,145,091 (GRCm38) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,117,697 (GRCm38) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,117,696 (GRCm38) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,146,856 (GRCm38) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,027,901 (GRCm38) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,113,934 (GRCm38) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6073:Piezo2 UTSW 18 63,012,645 (GRCm38) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,157,210 (GRCm38) nonsense probably null
R6255:Piezo2 UTSW 18 63,121,270 (GRCm38) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,117,678 (GRCm38) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,106,293 (GRCm38) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,086,607 (GRCm38) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,041,663 (GRCm38) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,106,271 (GRCm38) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,021,328 (GRCm38) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,021,262 (GRCm38) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,032,889 (GRCm38) nonsense probably null
R6855:Piezo2 UTSW 18 63,090,879 (GRCm38) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,032,986 (GRCm38) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,082,961 (GRCm38) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,145,110 (GRCm38) nonsense probably null
R7162:Piezo2 UTSW 18 63,124,709 (GRCm38) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,108,030 (GRCm38) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,017,519 (GRCm38) splice site probably null
R7395:Piezo2 UTSW 18 63,027,563 (GRCm38) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,024,472 (GRCm38) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,012,723 (GRCm38) missense probably benign
R7517:Piezo2 UTSW 18 63,082,925 (GRCm38) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,053,010 (GRCm38) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,042,539 (GRCm38) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,113,876 (GRCm38) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,082,945 (GRCm38) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,083,200 (GRCm38) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,042,811 (GRCm38) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,030,466 (GRCm38) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,075,730 (GRCm38) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,012,786 (GRCm38) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,084,688 (GRCm38) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,045,540 (GRCm38) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,146,802 (GRCm38) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,092,900 (GRCm38) nonsense probably null
R8708:Piezo2 UTSW 18 63,093,015 (GRCm38) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8727:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8810:Piezo2 UTSW 18 63,114,963 (GRCm38) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,115,025 (GRCm38) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,092,831 (GRCm38) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,045,479 (GRCm38) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,117,744 (GRCm38) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,157,231 (GRCm38) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,021,301 (GRCm38) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,075,797 (GRCm38) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,024,566 (GRCm38) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,029,085 (GRCm38) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,102,165 (GRCm38) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,386,276 (GRCm38) start gained probably benign
R9608:Piezo2 UTSW 18 63,146,945 (GRCm38) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,115,037 (GRCm38) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,064,696 (GRCm38) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,027,586 (GRCm38) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,050,610 (GRCm38) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,017,577 (GRCm38) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,069,994 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAACAGGGTCCTACAAAGGCTG -3'
(R):5'- TGCATGCAAGAGTTAATAGCG -3'

Sequencing Primer
(F):5'- GGACGAGACCTTCTTCTGACATG -3'
(R):5'- GCGTTTAAGTCTTGATCAGTTCAC -3'
Posted On 2014-10-15