Incidental Mutation 'R2231:Trdmt1'
ID240024
Institutional Source Beutler Lab
Gene Symbol Trdmt1
Ensembl Gene ENSMUSG00000026723
Gene NametRNA aspartic acid methyltransferase 1
SynonymsRnmt2, Dnmt2
MMRRC Submission 040232-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R2231 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location13509014-13544668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13525625 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 82 (F82I)
Ref Sequence ENSEMBL: ENSMUSP00000141758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124488] [ENSMUST00000144957]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028055
Predicted Effect probably damaging
Transcript: ENSMUST00000124488
AA Change: F82I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114572
Gene: ENSMUSG00000026723
AA Change: F82I

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 391 1.6e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144957
AA Change: F82I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141758
Gene: ENSMUSG00000026723
AA Change: F82I

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 84 4.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein responsible for the methylation of aspartic acid transfer RNA, specifically at the cytosine-38 residue in the anticodon loop. This enzyme also possesses residual DNA-(cytosine-C5) methyltransferase activity. While similar in sequence and structure to DNA cytosine methyltransferases, this gene is distinct and highly conserved in its function among taxa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased proportion of natural killer cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b G A 1: 36,700,359 R336W probably damaging Het
Alkbh6 G A 7: 30,312,590 probably null Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Arsa T C 15: 89,475,722 M1V probably null Het
Cblb T A 16: 52,194,272 S895T probably benign Het
Cdk8 A T 5: 146,231,604 probably benign Het
Coch G A 12: 51,602,865 V320I probably benign Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dnah5 G A 15: 28,408,417 probably null Het
Eif2b5 T C 16: 20,504,770 Y424H probably benign Het
Enoph1 C T 5: 100,040,277 T20I probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Nup153 A G 13: 46,709,627 probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1445 A G 19: 12,883,949 I23V probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plekhd1 T C 12: 80,721,951 F403L possibly damaging Het
Pou5f1 A G 17: 35,510,062 T134A probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sacs A G 14: 61,205,929 probably null Het
Sbno1 A T 5: 124,405,704 D257E probably damaging Het
Scn10a T C 9: 119,633,850 E1040G possibly damaging Het
Sgce T C 6: 4,730,066 K53E probably benign Het
Slc6a11 A G 6: 114,194,629 T254A probably damaging Het
Spag1 A G 15: 36,191,167 Y180C probably benign Het
Ssna1 G T 2: 25,272,007 N58K possibly damaging Het
Tbx3 C A 5: 119,677,524 N296K probably damaging Het
Tcerg1 A G 18: 42,524,244 T264A unknown Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp33 C T 3: 152,373,386 A425V probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Zw10 C T 9: 49,064,121 T282M possibly damaging Het
Other mutations in Trdmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Trdmt1 APN 2 13521260 splice site probably null
IGL01584:Trdmt1 APN 2 13519928 missense probably benign 0.00
IGL02491:Trdmt1 APN 2 13516672 missense probably benign 0.17
IGL03025:Trdmt1 APN 2 13523435 missense probably damaging 0.98
R0167:Trdmt1 UTSW 2 13516018 missense probably damaging 1.00
R0193:Trdmt1 UTSW 2 13544617 missense probably damaging 1.00
R0638:Trdmt1 UTSW 2 13516648 splice site probably benign
R0690:Trdmt1 UTSW 2 13544580 missense probably benign 0.01
R0735:Trdmt1 UTSW 2 13523438 missense probably benign 0.23
R1102:Trdmt1 UTSW 2 13523414 splice site probably benign
R1432:Trdmt1 UTSW 2 13519846 missense probably damaging 0.98
R1610:Trdmt1 UTSW 2 13516059 missense probably damaging 1.00
R1935:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R1936:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R2060:Trdmt1 UTSW 2 13519914 missense probably benign 0.01
R2339:Trdmt1 UTSW 2 13520060 nonsense probably null
R3703:Trdmt1 UTSW 2 13521297 missense probably benign 0.16
R3735:Trdmt1 UTSW 2 13519873 missense possibly damaging 0.51
R4751:Trdmt1 UTSW 2 13544653 utr 5 prime probably benign
R6258:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6260:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6799:Trdmt1 UTSW 2 13516013 critical splice donor site probably null
R7329:Trdmt1 UTSW 2 13516122 missense probably damaging 1.00
R8126:Trdmt1 UTSW 2 13520005 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TGCGGATTCCTATGCTCGATG -3'
(R):5'- AGCTGCGTTGTAAAGCTGTG -3'

Sequencing Primer
(F):5'- TGGGAAGATTCTATGCCCCAGTAC -3'
(R):5'- TAAAGCTGTGCTGTGGTATGGAAAC -3'
Posted On2014-10-15