Incidental Mutation 'R0184:Fbxo11'
ID24003
Institutional Source Beutler Lab
Gene Symbol Fbxo11
Ensembl Gene ENSMUSG00000005371
Gene NameF-box protein 11
SynonymsJf, GENA 104
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0184 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location87990859-88065291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88008673 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 443 (N443I)
Ref Sequence ENSEMBL: ENSMUSP00000005504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005504]
Predicted Effect probably benign
Transcript: ENSMUST00000005504
AA Change: N443I

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371
AA Change: N443I

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130379
AA Change: N367I
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371
AA Change: N367I

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000135639
AA Change: N8I
Meta Mutation Damage Score 0.4580 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cleft palate, facial clefting, and perinatal lethality. Mice homozygous for a knock-out allele show neonatal lethality, thick epidermis, decreased hair follicle number, absent keratohyalin granules, and increased epidermal Snail protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Fbxo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Fbxo11 APN 17 88002896 missense probably benign 0.02
IGL01908:Fbxo11 APN 17 87992300 missense probably benign 0.10
IGL02012:Fbxo11 APN 17 88012651 missense probably benign 0.00
IGL02149:Fbxo11 APN 17 87993759 missense possibly damaging 0.85
IGL02223:Fbxo11 APN 17 88009286 missense probably benign 0.03
IGL02586:Fbxo11 APN 17 88011283 unclassified probably benign
IGL03265:Fbxo11 APN 17 87992831 missense probably damaging 1.00
R0335:Fbxo11 UTSW 17 88015613 missense possibly damaging 0.90
R0918:Fbxo11 UTSW 17 87997603 missense probably damaging 1.00
R1658:Fbxo11 UTSW 17 88012658 missense probably benign 0.01
R3725:Fbxo11 UTSW 17 88009286 missense probably benign 0.03
R4194:Fbxo11 UTSW 17 88009108 missense possibly damaging 0.94
R4884:Fbxo11 UTSW 17 87992333 missense probably damaging 0.99
R4902:Fbxo11 UTSW 17 88065274 unclassified probably benign
R5651:Fbxo11 UTSW 17 88015708 missense probably benign 0.01
R6137:Fbxo11 UTSW 17 88008669 missense probably benign 0.00
R6217:Fbxo11 UTSW 17 88008904 missense probably benign 0.00
R6482:Fbxo11 UTSW 17 88012658 missense probably benign 0.01
R7383:Fbxo11 UTSW 17 88002854 missense
R7813:Fbxo11 UTSW 17 88000817 missense
R7823:Fbxo11 UTSW 17 87993182 missense probably damaging 0.98
RF002:Fbxo11 UTSW 17 87996053 missense
X0060:Fbxo11 UTSW 17 87992306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCATGAGAACTACTGGGTGAG -3'
(R):5'- TCAGTGACTGTGAAAACGTCGGAC -3'

Sequencing Primer
(F):5'- GGCTTCAAAGATCATTATCAATTCG -3'
(R):5'- ACAGATCATGCACAGGTACTT -3'
Posted On2013-04-16