Incidental Mutation 'R0184:Zeb1'
List |< first << previous [record 74 of 75] next >> last >|
ID24004
Institutional Source Beutler Lab
Gene Symbol Zeb1
Ensembl Gene ENSMUSG00000024238
Gene Namezinc finger E-box binding homeobox 1
Synonyms3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1
MMRRC Submission 038449-MU
Accession Numbers

Genbank: NM_011546; MGI: 1344313

Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R0184 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location5591860-5775467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5766808 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 440 (I440F)
Ref Sequence ENSEMBL: ENSMUSP00000025081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025081] [ENSMUST00000159390] [ENSMUST00000175925]
Predicted Effect probably damaging
Transcript: ENSMUST00000025081
AA Change: I440F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: I440F

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 150 173 3.16e-3 SMART
ZnF_C2H2 180 202 3.21e-4 SMART
ZnF_C2H2 220 242 4.87e-4 SMART
ZnF_C2H2 248 268 1.86e1 SMART
low complexity region 288 304 N/A INTRINSIC
low complexity region 532 555 N/A INTRINSIC
HOX 559 621 7.53e-3 SMART
low complexity region 730 742 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
ZnF_C2H2 882 904 1.18e-2 SMART
ZnF_C2H2 910 932 4.4e-2 SMART
ZnF_C2H2 938 959 1.89e-1 SMART
coiled coil region 1006 1077 N/A INTRINSIC
low complexity region 1096 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159390
SMART Domains Protein: ENSMUSP00000124395
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 96 119 3.16e-3 SMART
ZnF_C2H2 126 148 3.21e-4 SMART
ZnF_C2H2 166 188 4.87e-4 SMART
ZnF_C2H2 194 214 1.86e1 SMART
low complexity region 234 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162892
SMART Domains Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 94 117 1.3e-5 SMART
ZnF_C2H2 124 146 1.3e-6 SMART
ZnF_C2H2 164 186 2e-6 SMART
ZnF_C2H2 192 212 7.8e-2 SMART
low complexity region 232 248 N/A INTRINSIC
low complexity region 476 499 N/A INTRINSIC
HOX 503 565 3.9e-5 SMART
low complexity region 674 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175925
SMART Domains Protein: ENSMUSP00000135125
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 130 153 3.16e-3 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
ZnF_C2H2 200 222 4.87e-4 SMART
ZnF_C2H2 228 248 1.86e1 SMART
low complexity region 268 284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177030
SMART Domains Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 22 44 4.87e-4 SMART
low complexity region 277 300 N/A INTRINSIC
HOX 304 366 7.53e-3 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
ZnF_C2H2 627 649 1.18e-2 SMART
ZnF_C2H2 655 677 4.4e-2 SMART
ZnF_C2H2 683 704 1.89e-1 SMART
low complexity region 758 775 N/A INTRINSIC
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Zeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zeb1 APN 18 5767774 missense probably benign 0.00
IGL01139:Zeb1 APN 18 5705061 missense possibly damaging 0.69
IGL01444:Zeb1 APN 18 5767906 missense probably damaging 1.00
IGL01444:Zeb1 APN 18 5767138 missense probably benign
IGL01806:Zeb1 APN 18 5767867 missense possibly damaging 0.94
IGL01988:Zeb1 APN 18 5759037 nonsense probably null
IGL02059:Zeb1 APN 18 5766892 missense probably damaging 1.00
IGL03005:Zeb1 APN 18 5767150 missense probably benign 0.03
IGL03153:Zeb1 APN 18 5770511 missense probably damaging 1.00
Apes UTSW 18 5761394 missense probably damaging 1.00
cellophane UTSW 18 5770554 nonsense probably null
serpens UTSW 18 5772455 missense probably damaging 1.00
N/A - 293:Zeb1 UTSW 18 5767076 missense possibly damaging 0.68
R0488:Zeb1 UTSW 18 5772455 missense probably damaging 1.00
R0622:Zeb1 UTSW 18 5759123 nonsense probably null
R0646:Zeb1 UTSW 18 5759027 missense probably damaging 1.00
R0881:Zeb1 UTSW 18 5767138 missense probably benign
R1251:Zeb1 UTSW 18 5705089 missense probably damaging 1.00
R1257:Zeb1 UTSW 18 5772699 missense possibly damaging 0.53
R1501:Zeb1 UTSW 18 5761399 missense possibly damaging 0.95
R1547:Zeb1 UTSW 18 5767450 missense possibly damaging 0.50
R1797:Zeb1 UTSW 18 5766298 nonsense probably null
R1815:Zeb1 UTSW 18 5767898 missense probably damaging 1.00
R2090:Zeb1 UTSW 18 5766458 missense possibly damaging 0.65
R2129:Zeb1 UTSW 18 5767681 missense possibly damaging 0.92
R2875:Zeb1 UTSW 18 5772859 small insertion probably benign
R3888:Zeb1 UTSW 18 5748743 missense probably damaging 1.00
R3941:Zeb1 UTSW 18 5767799 missense probably benign 0.06
R3952:Zeb1 UTSW 18 5772716 missense probably benign 0.17
R4271:Zeb1 UTSW 18 5758985 missense probably damaging 0.99
R4512:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4514:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4677:Zeb1 UTSW 18 5766775 missense probably damaging 0.97
R4729:Zeb1 UTSW 18 5767286 missense probably damaging 1.00
R5839:Zeb1 UTSW 18 5767507 missense probably benign
R5913:Zeb1 UTSW 18 5766765 missense possibly damaging 0.49
R6248:Zeb1 UTSW 18 5766962 missense probably damaging 1.00
R6354:Zeb1 UTSW 18 5772743 missense possibly damaging 0.64
R6429:Zeb1 UTSW 18 5770498 missense probably damaging 1.00
R6819:Zeb1 UTSW 18 5591917 missense probably damaging 1.00
R7180:Zeb1 UTSW 18 5767867 missense possibly damaging 0.94
R7193:Zeb1 UTSW 18 5772756 missense probably damaging 0.98
R7199:Zeb1 UTSW 18 5767703 missense probably benign 0.00
R7397:Zeb1 UTSW 18 5761394 missense probably damaging 1.00
R7534:Zeb1 UTSW 18 5766611 missense probably damaging 1.00
R7702:Zeb1 UTSW 18 5766802 missense probably damaging 1.00
R7703:Zeb1 UTSW 18 5766917 missense probably benign
R7934:Zeb1 UTSW 18 5748703 missense probably benign 0.00
R8504:Zeb1 UTSW 18 5705127 missense possibly damaging 0.94
R8539:Zeb1 UTSW 18 5748784 missense probably damaging 0.99
R8716:Zeb1 UTSW 18 5767958 missense probably damaging 0.99
R8772:Zeb1 UTSW 18 5770382 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGCAGGCAACCAGTTCTCCTC -3'
(R):5'- CCTCACACAGAAGGCAAGTGCTATC -3'

Sequencing Primer
(F):5'- AACCAGTTCTCCTCAGGGTG -3'
(R):5'- AGGCAAGTGCTATCATCCCTG -3'
Posted On2013-04-16