Incidental Mutation 'R2231:Zw10'
ID240043
Institutional Source Beutler Lab
Gene Symbol Zw10
Ensembl Gene ENSMUSG00000032264
Gene Namezw10 kinetochore protein
SynonymsMmZw10, 6330566F14Rik
MMRRC Submission 040232-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2231 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location49055613-49078775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49064121 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 282 (T282M)
Ref Sequence ENSEMBL: ENSMUSP00000034803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034803]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034803
AA Change: T282M

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034803
Gene: ENSMUSG00000032264
AA Change: T282M

DomainStartEndE-ValueType
Pfam:Zw10 9 621 2.1e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215706
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b G A 1: 36,700,359 R336W probably damaging Het
Alkbh6 G A 7: 30,312,590 probably null Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Arsa T C 15: 89,475,722 M1V probably null Het
Cblb T A 16: 52,194,272 S895T probably benign Het
Cdk8 A T 5: 146,231,604 probably benign Het
Coch G A 12: 51,602,865 V320I probably benign Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dnah5 G A 15: 28,408,417 probably null Het
Eif2b5 T C 16: 20,504,770 Y424H probably benign Het
Enoph1 C T 5: 100,040,277 T20I probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Nup153 A G 13: 46,709,627 probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1445 A G 19: 12,883,949 I23V probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plekhd1 T C 12: 80,721,951 F403L possibly damaging Het
Pou5f1 A G 17: 35,510,062 T134A probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sacs A G 14: 61,205,929 probably null Het
Sbno1 A T 5: 124,405,704 D257E probably damaging Het
Scn10a T C 9: 119,633,850 E1040G possibly damaging Het
Sgce T C 6: 4,730,066 K53E probably benign Het
Slc6a11 A G 6: 114,194,629 T254A probably damaging Het
Spag1 A G 15: 36,191,167 Y180C probably benign Het
Ssna1 G T 2: 25,272,007 N58K possibly damaging Het
Tbx3 C A 5: 119,677,524 N296K probably damaging Het
Tcerg1 A G 18: 42,524,244 T264A unknown Het
Trdmt1 A T 2: 13,525,625 F82I probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp33 C T 3: 152,373,386 A425V probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in Zw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Zw10 APN 9 49069615 missense probably benign
IGL02111:Zw10 APN 9 49068754 missense probably damaging 0.98
IGL02673:Zw10 APN 9 49077593 splice site probably null
PIT4382001:Zw10 UTSW 9 49071644 missense probably benign 0.15
R0402:Zw10 UTSW 9 49068723 missense probably benign 0.00
R0736:Zw10 UTSW 9 49064132 missense probably benign 0.00
R1830:Zw10 UTSW 9 49069741 missense probably damaging 1.00
R1966:Zw10 UTSW 9 49068833 missense probably damaging 1.00
R2474:Zw10 UTSW 9 49066805 missense probably damaging 1.00
R2849:Zw10 UTSW 9 49057641 critical splice acceptor site probably null
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R4893:Zw10 UTSW 9 49074025 missense possibly damaging 0.58
R4927:Zw10 UTSW 9 49068683 missense probably damaging 1.00
R5070:Zw10 UTSW 9 49077459 nonsense probably null
R5214:Zw10 UTSW 9 49064163 missense possibly damaging 0.91
R5637:Zw10 UTSW 9 49057650 missense probably damaging 1.00
R5983:Zw10 UTSW 9 49077445 splice site probably null
R6368:Zw10 UTSW 9 49073235 missense probably damaging 1.00
R6605:Zw10 UTSW 9 49069626 missense probably benign 0.00
R7221:Zw10 UTSW 9 49069712 missense probably benign 0.00
R7292:Zw10 UTSW 9 49061191 missense probably benign 0.00
R7938:Zw10 UTSW 9 49071633 missense probably benign 0.04
R8120:Zw10 UTSW 9 49074113 missense probably benign 0.26
R8376:Zw10 UTSW 9 49077483 missense possibly damaging 0.85
RF007:Zw10 UTSW 9 49060920 missense possibly damaging 0.81
Z1177:Zw10 UTSW 9 49074096 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCTGGGATTAAAGGCAGCC -3'
(R):5'- ACTTAGCCCAGGTTTCAGCC -3'

Sequencing Primer
(F):5'- CCTTTCTTTACGTTTGGGGATTTC -3'
(R):5'- GCCCTTTTGCTCTAAGAATAACAC -3'
Posted On2014-10-15