Incidental Mutation 'R2231:Coch'
ID240048
Institutional Source Beutler Lab
Gene Symbol Coch
Ensembl Gene ENSMUSG00000020953
Gene Namecochlin
SynonymsCoch-5B2, D12H14S564E
MMRRC Submission 040232-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2231 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location51593341-51605771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 51602865 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 320 (V320I)
Ref Sequence ENSEMBL: ENSMUSP00000128127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085412] [ENSMUST00000164782]
Predicted Effect probably benign
Transcript: ENSMUST00000085412
AA Change: V320I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953
AA Change: V320I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164782
AA Change: V320I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953
AA Change: V320I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a point mutation have vestibular and hearing dysfunctions that worsen with age. Homozyogtes for a null allele have no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b G A 1: 36,700,359 R336W probably damaging Het
Alkbh6 G A 7: 30,312,590 probably null Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Arsa T C 15: 89,475,722 M1V probably null Het
Cblb T A 16: 52,194,272 S895T probably benign Het
Cdk8 A T 5: 146,231,604 probably benign Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dnah5 G A 15: 28,408,417 probably null Het
Eif2b5 T C 16: 20,504,770 Y424H probably benign Het
Enoph1 C T 5: 100,040,277 T20I probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Nup153 A G 13: 46,709,627 probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1445 A G 19: 12,883,949 I23V probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plekhd1 T C 12: 80,721,951 F403L possibly damaging Het
Pou5f1 A G 17: 35,510,062 T134A probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sacs A G 14: 61,205,929 probably null Het
Sbno1 A T 5: 124,405,704 D257E probably damaging Het
Scn10a T C 9: 119,633,850 E1040G possibly damaging Het
Sgce T C 6: 4,730,066 K53E probably benign Het
Slc6a11 A G 6: 114,194,629 T254A probably damaging Het
Spag1 A G 15: 36,191,167 Y180C probably benign Het
Ssna1 G T 2: 25,272,007 N58K possibly damaging Het
Tbx3 C A 5: 119,677,524 N296K probably damaging Het
Tcerg1 A G 18: 42,524,244 T264A unknown Het
Trdmt1 A T 2: 13,525,625 F82I probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp33 C T 3: 152,373,386 A425V probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Zw10 C T 9: 49,064,121 T282M possibly damaging Het
Other mutations in Coch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Coch APN 12 51603353 missense probably damaging 1.00
IGL01803:Coch APN 12 51603299 missense probably benign 0.15
IGL02613:Coch APN 12 51595349 missense possibly damaging 0.76
IGL02697:Coch APN 12 51597038 missense probably benign 0.00
IGL03351:Coch APN 12 51603206 missense probably benign 0.05
R0732:Coch UTSW 12 51595372 missense probably damaging 1.00
R1485:Coch UTSW 12 51598289 missense probably damaging 1.00
R1757:Coch UTSW 12 51602848 missense probably damaging 1.00
R2073:Coch UTSW 12 51602689 missense probably benign 0.00
R2440:Coch UTSW 12 51596562 missense probably damaging 0.99
R3104:Coch UTSW 12 51603421 missense probably benign
R3623:Coch UTSW 12 51602826 missense probably benign 0.06
R3624:Coch UTSW 12 51602826 missense probably benign 0.06
R3932:Coch UTSW 12 51603338 missense probably damaging 1.00
R3933:Coch UTSW 12 51603338 missense probably damaging 1.00
R3945:Coch UTSW 12 51601812 critical splice acceptor site probably null
R3946:Coch UTSW 12 51601812 critical splice acceptor site probably null
R4423:Coch UTSW 12 51598149 splice site probably null
R4660:Coch UTSW 12 51595485 missense probably benign 0.21
R4732:Coch UTSW 12 51605019 missense probably benign 0.28
R4733:Coch UTSW 12 51605019 missense probably benign 0.28
R4844:Coch UTSW 12 51602694 missense probably damaging 0.98
R4997:Coch UTSW 12 51603181 splice site probably null
R5152:Coch UTSW 12 51595442 missense probably benign 0.00
R5173:Coch UTSW 12 51596507 nonsense probably null
R6134:Coch UTSW 12 51602753 missense probably damaging 1.00
R6481:Coch UTSW 12 51598173 missense probably damaging 1.00
R6497:Coch UTSW 12 51602721 missense probably benign 0.06
R6714:Coch UTSW 12 51602737 missense probably damaging 1.00
R6896:Coch UTSW 12 51602869 missense possibly damaging 0.62
R7242:Coch UTSW 12 51593561 start gained probably benign
R7463:Coch UTSW 12 51593625 start codon destroyed probably null 0.02
R7595:Coch UTSW 12 51598233 missense probably damaging 1.00
R8047:Coch UTSW 12 51603713 critical splice donor site probably null
R8085:Coch UTSW 12 51603248 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTCAGAAATTCTTTACAGCAGACAC -3'
(R):5'- CATGTGTTCCCAGGCCTTTG -3'

Sequencing Primer
(F):5'- CACTGGTGTGAGAAAAGGAATACC -3'
(R):5'- TTAATTGCATAGGCTGGCCC -3'
Posted On2014-10-15