Incidental Mutation 'R2231:Eif2b5'
ID240060
Institutional Source Beutler Lab
Gene Symbol Eif2b5
Ensembl Gene ENSMUSG00000003235
Gene Nameeukaryotic translation initiation factor 2B, subunit 5 epsilon
Synonyms
MMRRC Submission 040232-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R2231 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20498817-20509323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20504770 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 424 (Y424H)
Ref Sequence ENSEMBL: ENSMUSP00000003320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003320] [ENSMUST00000148714]
Predicted Effect probably benign
Transcript: ENSMUST00000003320
AA Change: Y424H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003320
Gene: ENSMUSG00000003235
AA Change: Y424H

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:Hexapep 341 372 9.8e-5 PFAM
Pfam:Hexapep 361 389 6.1e-6 PFAM
low complexity region 517 526 N/A INTRINSIC
eIF5C 625 712 8.43e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148714
SMART Domains Protein: ENSMUSP00000121169
Gene: ENSMUSG00000003235

DomainStartEndE-ValueType
Pfam:W2 82 150 7e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000231315
AA Change: Y3H
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal brain white matter development, decreased body fat, demyelination, impaired recovery from cuprizone-induced demyelination, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b G A 1: 36,700,359 R336W probably damaging Het
Alkbh6 G A 7: 30,312,590 probably null Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Arsa T C 15: 89,475,722 M1V probably null Het
Cblb T A 16: 52,194,272 S895T probably benign Het
Cdk8 A T 5: 146,231,604 probably benign Het
Coch G A 12: 51,602,865 V320I probably benign Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dnah5 G A 15: 28,408,417 probably null Het
Enoph1 C T 5: 100,040,277 T20I probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Nup153 A G 13: 46,709,627 probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1445 A G 19: 12,883,949 I23V probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plekhd1 T C 12: 80,721,951 F403L possibly damaging Het
Pou5f1 A G 17: 35,510,062 T134A probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sacs A G 14: 61,205,929 probably null Het
Sbno1 A T 5: 124,405,704 D257E probably damaging Het
Scn10a T C 9: 119,633,850 E1040G possibly damaging Het
Sgce T C 6: 4,730,066 K53E probably benign Het
Slc6a11 A G 6: 114,194,629 T254A probably damaging Het
Spag1 A G 15: 36,191,167 Y180C probably benign Het
Ssna1 G T 2: 25,272,007 N58K possibly damaging Het
Tbx3 C A 5: 119,677,524 N296K probably damaging Het
Tcerg1 A G 18: 42,524,244 T264A unknown Het
Trdmt1 A T 2: 13,525,625 F82I probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp33 C T 3: 152,373,386 A425V probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Zw10 C T 9: 49,064,121 T282M possibly damaging Het
Other mutations in Eif2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Eif2b5 APN 16 20505252 missense probably benign 0.19
IGL01073:Eif2b5 APN 16 20500296 nonsense probably null
IGL01467:Eif2b5 APN 16 20508964 nonsense probably null
IGL02754:Eif2b5 APN 16 20502786 missense possibly damaging 0.50
IGL03286:Eif2b5 APN 16 20502262 missense probably damaging 1.00
R0569:Eif2b5 UTSW 16 20502553 missense probably benign 0.13
R1321:Eif2b5 UTSW 16 20504689 nonsense probably null
R1647:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1648:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1897:Eif2b5 UTSW 16 20507037 missense probably damaging 0.99
R3196:Eif2b5 UTSW 16 20505522 missense probably benign
R4423:Eif2b5 UTSW 16 20501719 missense probably benign 0.10
R4776:Eif2b5 UTSW 16 20500233 missense probably damaging 1.00
R5240:Eif2b5 UTSW 16 20501398 missense possibly damaging 0.49
R5828:Eif2b5 UTSW 16 20502786 missense possibly damaging 0.50
R5920:Eif2b5 UTSW 16 20498944 missense unknown
R5925:Eif2b5 UTSW 16 20508124 missense probably benign 0.02
R6717:Eif2b5 UTSW 16 20505283 missense probably damaging 0.96
R6915:Eif2b5 UTSW 16 20502750 missense possibly damaging 0.83
R7396:Eif2b5 UTSW 16 20506137 missense possibly damaging 0.69
R8046:Eif2b5 UTSW 16 20506404 missense possibly damaging 0.88
R8196:Eif2b5 UTSW 16 20502556 missense probably damaging 0.99
R8503:Eif2b5 UTSW 16 20498980 missense probably benign 0.23
R8532:Eif2b5 UTSW 16 20505206 missense probably damaging 0.99
Z1187:Eif2b5 UTSW 16 20498921 missense unknown
Z1192:Eif2b5 UTSW 16 20498921 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTCTGTGAAGGACTCTTTCGG -3'
(R):5'- AGAACTGTGTCTTGACAATCAGAAC -3'

Sequencing Primer
(F):5'- ACTCTTTCGGATGTGGGACCC -3'
(R):5'- AGAGAAACTGGGGCTCTT -3'
Posted On2014-10-15