Mutagenetix > Incidental Mutation

Incidental Mutation 'R0184:Arhgap26'

24007

Institutional Source

Beutler Lab

Gene Symbol

Arhgap26

Ensembl Gene

ENSMUSG00000036452

Gene Name

Rho GTPase activating protein 26

Synonyms

2610010G17Rik, 1810044B20Rik, 4933432P15Rik

MMRRC Submission

038449-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0184 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

38601534-39376284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 38617673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 46 (D46E)

AlphaFold

Q6ZQ82

Predicted Effect

unknown
Transcript: ENSMUST00000097595
AA Change: D46E

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145090

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.9%

Validation Efficiency

66% (50/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	A	3: 124,419,250	V131F	probably damaging	Het
Adam28	T	C	14: 68,637,373	D285G	probably benign	Het
Akr1c13	A	G	13: 4,194,056	E36G	probably damaging	Het
Antxr2	A	G	5: 97,980,030	L214S	probably damaging	Het
Armc9	T	C	1: 86,198,370	L61P	probably damaging	Het
Bicc1	C	A	10: 71,079,215	R73L	probably benign	Het
Calm2	T	C	17: 87,435,841	N43S	probably benign	Het
Cct7	A	G	6: 85,461,554	D105G	probably null	Het
Cdk18	T	C	1: 132,118,538	N215D	probably benign	Het
Cep126	T	C	9: 8,103,395	T205A	probably benign	Het
Cfap57	A	T	4: 118,599,012	I495N	probably damaging	Het
Cyp2b9	T	A	7: 26,187,007	C152*	probably null	Het
Dab2ip	G	A	2: 35,718,791	R579H	probably damaging	Het
Dnah8	T	C	17: 30,683,683	V905A	probably benign	Het
Eif4h	C	A	5: 134,625,375	D134Y	possibly damaging	Het
Espl1	T	A	15: 102,299,216	S372T	probably benign	Het
Fat2	T	A	11: 55,296,288	H1244L	probably damaging	Het
Fbxo11	T	A	17: 88,008,673	N443I	probably benign	Het
Git2	G	A	5: 114,739,037	T128M	possibly damaging	Het
Gm10985	T	A	3: 53,845,258	Y21N	probably damaging	Het
Gm12790	A	T	4: 101,967,614	Y152*	probably null	Het
Heatr5a	T	C	12: 51,909,969	D1115G	probably benign	Het
Hipk2	T	C	6: 38,718,931	N726S	possibly damaging	Het
Hrg	T	C	16: 22,953,771		probably null	Het
Iars	T	G	13: 49,722,212	S792A	probably benign	Het
Igf1r	A	G	7: 68,226,193	N1301S	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Ilkap	T	C	1: 91,376,305		probably benign	Het
Ints13	A	T	6: 146,555,044	Y435N	probably benign	Het
Ints8	A	C	4: 11,218,637	S797A	probably benign	Het
Itgad	T	A	7: 128,189,231	D405E	probably benign	Het
Itgam	A	T	7: 128,086,058	I448F	probably damaging	Het
Klk1	C	T	7: 44,228,749	T41I	possibly damaging	Het
Mcrip1	T	C	11: 120,544,884	M1V	probably null	Het
Mdga1	A	G	17: 29,852,442	Y128H	probably damaging	Het
Mtor	G	T	4: 148,464,971	R604L	probably benign	Het
Olfr1170	A	T	2: 88,224,780	L84*	probably null	Het
Olfr656	T	C	7: 104,618,240	V187A	probably damaging	Het
Pcdhb7	T	A	18: 37,343,390	D526E	probably benign	Het
Pip4k2a	T	C	2: 18,889,128	D139G	probably damaging	Het
Pkp3	A	C	7: 141,088,367	N536T	probably benign	Het
Pla2g4c	T	A	7: 13,356,220	S524T	probably benign	Het
Pno1	T	C	11: 17,211,127	E69G	probably benign	Het
Pold1	C	T	7: 44,541,715	V231M	probably benign	Het
Poli	A	G	18: 70,522,731	S248P	probably damaging	Het
Ppox	C	T	1: 171,279,552	S138N	probably damaging	Het
Psg20	T	C	7: 18,685,976	E6G	probably null	Het
Rbmx	C	T	X: 57,391,566		probably null	Het
Rln1	T	A	19: 29,331,936	K148*	probably null	Het
Rnf213	C	T	11: 119,414,521	T526I	probably damaging	Het
Rps6kc1	A	T	1: 190,799,093	V904E	probably null	Het
Sf3b2	T	A	19: 5,283,672	I633F	probably damaging	Het
Sfswap	T	A	5: 129,507,189	I189N	probably damaging	Het
Smarca2	T	A	19: 26,692,249	Y973*	probably null	Het
Spink5	G	A	18: 44,003,198	D559N	probably benign	Het
Spty2d1	C	T	7: 46,997,574	V536I	possibly damaging	Het
Tbx3	T	C	5: 119,675,562	I221T	probably damaging	Het
Tcf20	T	A	15: 82,852,300	D1650V	probably damaging	Het
Thsd7b	A	G	1: 129,430,964	K45R	probably benign	Het
Tirap	A	G	9: 35,189,194	S65P	probably benign	Het
Trim25	C	T	11: 88,999,640	P51L	probably damaging	Het
Trim61	T	C	8: 65,014,417	N64S	probably benign	Het
Twf1	T	A	15: 94,581,067		probably null	Het
Ubr4	A	C	4: 139,445,262	T1692P	probably damaging	Het
Usp3	A	G	9: 66,562,581	M86T	probably damaging	Het
Utrn	T	C	10: 12,667,618	D1762G	probably benign	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Vmn2r52	T	C	7: 10,159,338	S625G	probably damaging	Het
Vmn2r90	G	A	17: 17,726,877	W472*	probably null	Het
Vrk2	C	A	11: 26,550,046	A56S	probably damaging	Het
Yeats2	C	T	16: 20,203,685	P620S	possibly damaging	Het
Zbtb21	C	T	16: 97,950,513	D171N	probably damaging	Het
Zeb1	A	T	18: 5,766,808	I440F	probably damaging	Het
Zfp292	A	G	4: 34,819,563	I253T	probably damaging	Het

Other mutations in Arhgap26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Arhgap26	APN	18	39286551	missense	probably damaging	1.00
IGL01116:Arhgap26	APN	18	39111803	missense	probably damaging	0.97
IGL01409:Arhgap26	APN	18	39110451	splice site	probably benign
IGL02316:Arhgap26	APN	18	38642546	exon	noncoding transcript
IGL02418:Arhgap26	APN	18	39357567	intron	probably benign
IGL02588:Arhgap26	APN	18	38601617	unclassified	probably benign
IGL03241:Arhgap26	APN	18	39229917	missense	probably damaging	1.00
R0244:Arhgap26	UTSW	18	39363131	missense	probably benign	0.05
R0347:Arhgap26	UTSW	18	38617744	missense	unknown
R1533:Arhgap26	UTSW	18	39371077	missense	probably benign	0.16
R1606:Arhgap26	UTSW	18	39296872	missense	probably damaging	1.00
R2066:Arhgap26	UTSW	18	39306728	missense	probably damaging	1.00
R2182:Arhgap26	UTSW	18	39357809	intron	probably benign
R2291:Arhgap26	UTSW	18	39357698	intron	probably benign
R3611:Arhgap26	UTSW	18	38933919	missense	probably benign
R3700:Arhgap26	UTSW	18	39120184	missense	probably damaging	0.99
R3887:Arhgap26	UTSW	18	39229966	critical splice donor site	probably null
R4621:Arhgap26	UTSW	18	38899841	intron	probably benign
R4877:Arhgap26	UTSW	18	39296929	splice site	probably null
R4910:Arhgap26	UTSW	18	38993637	splice site	probably benign
R4911:Arhgap26	UTSW	18	38993637	splice site	probably benign
R4954:Arhgap26	UTSW	18	39243641	missense	probably benign	0.00
R4967:Arhgap26	UTSW	18	39246840	missense	probably damaging	1.00
R5221:Arhgap26	UTSW	18	39110472	nonsense	probably null
R5232:Arhgap26	UTSW	18	38993476	start codon destroyed	probably null	0.97
R5297:Arhgap26	UTSW	18	39121888	missense	probably damaging	1.00
R5372:Arhgap26	UTSW	18	38642456	exon	noncoding transcript
R5570:Arhgap26	UTSW	18	39099618	missense	probably damaging	0.99
R5692:Arhgap26	UTSW	18	39121892	missense	probably damaging	1.00
R5752:Arhgap26	UTSW	18	39286672	missense	probably damaging	1.00
R5930:Arhgap26	UTSW	18	39150092	missense	probably damaging	0.96
R6131:Arhgap26	UTSW	18	39286585	nonsense	probably null
R6251:Arhgap26	UTSW	18	39357827	missense	probably null
R6481:Arhgap26	UTSW	18	39150057	missense	probably damaging	1.00
R6622:Arhgap26	UTSW	18	38899863	intron	probably benign
R6799:Arhgap26	UTSW	18	39099607	missense	probably damaging	1.00
R6878:Arhgap26	UTSW	18	39227412	missense	probably damaging	1.00
R6989:Arhgap26	UTSW	18	39099629	missense	probably damaging	1.00
R7248:Arhgap26	UTSW	18	39306854	critical splice donor site	probably null
R7936:Arhgap26	UTSW	18	39205287	missense	probably damaging	1.00
R7960:Arhgap26	UTSW	18	39229927	missense
R8103:Arhgap26	UTSW	18	39371124	missense
R8206:Arhgap26	UTSW	18	39306750	nonsense	probably null
R8356:Arhgap26	UTSW	18	39111848	missense	possibly damaging	0.89
R8456:Arhgap26	UTSW	18	39111848	missense	possibly damaging	0.89
R8987:Arhgap26	UTSW	18	39357599	missense
R9025:Arhgap26	UTSW	18	39246845	missense
R9149:Arhgap26	UTSW	18	39111864	missense	possibly damaging	0.94
R9172:Arhgap26	UTSW	18	39245329	missense	probably damaging	1.00
R9191:Arhgap26	UTSW	18	39306840	missense
R9576:Arhgap26	UTSW	18	39120154	nonsense	probably null
X0013:Arhgap26	UTSW	18	39371112	missense	probably damaging	1.00
X0025:Arhgap26	UTSW	18	39150105	missense	probably damaging	1.00
Z1088:Arhgap26	UTSW	18	39357671	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- CGCAAAGTATCACAGTCCTGCTTCC -3'
(R):5'- AATGCATCCACTGACTTACTCACCG -3'

Sequencing Primer
(F):5'- ACATCAGTCCCTGTCTGAGG -3'
(R):5'- ACTCACCGTTCAGCATCG -3'

Posted On

2013-04-16