Incidental Mutation 'R2232:Pth2r'
ID240074
Institutional Source Beutler Lab
Gene Symbol Pth2r
Ensembl Gene ENSMUSG00000025946
Gene Nameparathyroid hormone 2 receptor
SynonymsPthr2
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2232 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location65282056-65389244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65336769 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 62 (W62L)
Ref Sequence ENSEMBL: ENSMUSP00000114594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027083] [ENSMUST00000140190]
Predicted Effect probably damaging
Transcript: ENSMUST00000027083
AA Change: W67L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: W67L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
HormR 59 134 8.15e-28 SMART
Pfam:7tm_2 139 406 5.1e-81 PFAM
low complexity region 447 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140190
AA Change: W62L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114594
Gene: ENSMUSG00000025946
AA Change: W62L

DomainStartEndE-ValueType
HormR 54 129 8.15e-28 SMART
Pfam:7tm_2 134 174 1.1e-13 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adamtsl2 G A 2: 27,103,178 G740E probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
BC027072 A G 17: 71,749,284 S1133P probably benign Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kansl2 A G 15: 98,524,478 L403S probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mindy3 C A 2: 12,404,045 R73M probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Nes T A 3: 87,978,931 I1499N possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
St5 T C 7: 109,557,207 D112G probably benign Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Thegl A G 5: 77,059,405 I337V possibly damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in Pth2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Pth2r APN 1 65388725 missense probably benign 0.08
IGL02054:Pth2r APN 1 65336781 missense probably damaging 1.00
IGL02429:Pth2r APN 1 65346839 missense probably benign 0.05
R0277:Pth2r UTSW 1 65388616 missense probably benign
R0323:Pth2r UTSW 1 65388616 missense probably benign
R0415:Pth2r UTSW 1 65388439 missense probably benign
R1067:Pth2r UTSW 1 65372348 missense possibly damaging 0.92
R1463:Pth2r UTSW 1 65363277 missense probably damaging 0.96
R1566:Pth2r UTSW 1 65388538 missense possibly damaging 0.50
R1690:Pth2r UTSW 1 65372303 missense probably benign 0.02
R1710:Pth2r UTSW 1 65336838 missense possibly damaging 0.48
R1957:Pth2r UTSW 1 65372355 missense probably damaging 1.00
R2062:Pth2r UTSW 1 65343562 missense probably damaging 1.00
R2942:Pth2r UTSW 1 65388476 missense probably benign 0.00
R3011:Pth2r UTSW 1 65336988 missense probably benign 0.05
R3857:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3858:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3859:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R4540:Pth2r UTSW 1 65282201 missense probably benign
R4694:Pth2r UTSW 1 65336761 missense probably benign
R4777:Pth2r UTSW 1 65388517 missense possibly damaging 0.90
R4926:Pth2r UTSW 1 65321984 missense probably benign 0.27
R5209:Pth2r UTSW 1 65388697 missense probably benign 0.04
R5871:Pth2r UTSW 1 65388637 missense probably damaging 1.00
R6868:Pth2r UTSW 1 65388479 missense probably benign 0.02
R7132:Pth2r UTSW 1 65322066 missense probably benign 0.00
R7242:Pth2r UTSW 1 65388620 missense probably benign 0.42
R7677:Pth2r UTSW 1 65388446 missense probably benign 0.00
R7836:Pth2r UTSW 1 65351563 missense probably damaging 1.00
R7919:Pth2r UTSW 1 65351563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACAAAGTGACTAAGCAGGTG -3'
(R):5'- TCACTGAGGTTGCAAGTTCCC -3'

Sequencing Primer
(F):5'- TACAAAGTGACTAAGCAGGTGATTTG -3'
(R):5'- GGTTGCAAGTTCCCCCACAAG -3'
Posted On2014-10-15