Incidental Mutation 'R2232:Mindy3'
ID 240077
Institutional Source Beutler Lab
Gene Symbol Mindy3
Ensembl Gene ENSMUSG00000026767
Gene Name MINDY lysine 48 deubiquitinase 3
Synonyms 5830410F13Rik, 2310047O13Rik, 1810041E18Rik, Fam188a
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock # R2232 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 12347263-12419470 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 12404045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Methionine at position 73 (R73M)
Ref Sequence ENSEMBL: ENSMUSP00000120193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028105] [ENSMUST00000124515] [ENSMUST00000124603] [ENSMUST00000129489] [ENSMUST00000129993] [ENSMUST00000144645] [ENSMUST00000151529] [ENSMUST00000154899] [ENSMUST00000155530]
AlphaFold Q9CV28
Predicted Effect probably benign
Transcript: ENSMUST00000028105
AA Change: R120M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000028105
Gene: ENSMUSG00000026767
AA Change: R120M

DomainStartEndE-ValueType
DUF4205 9 351 1.48e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124515
AA Change: R73M

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120193
Gene: ENSMUSG00000026767
AA Change: R73M

DomainStartEndE-ValueType
Blast:DUF4205 9 94 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124603
SMART Domains Protein: ENSMUSP00000117457
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 79 8.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129348
SMART Domains Protein: ENSMUSP00000121265
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 3 160 3.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129489
SMART Domains Protein: ENSMUSP00000122501
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 84 9.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129993
SMART Domains Protein: ENSMUSP00000141479
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 3 87 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130225
Predicted Effect probably benign
Transcript: ENSMUST00000144645
SMART Domains Protein: ENSMUSP00000116836
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 87 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153690
Predicted Effect probably benign
Transcript: ENSMUST00000154899
SMART Domains Protein: ENSMUSP00000121476
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 1 110 6.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154952
Predicted Effect probably benign
Transcript: ENSMUST00000155530
AA Change: R120M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116939
Gene: ENSMUSG00000026767
AA Change: R120M

DomainStartEndE-ValueType
DUF4205 9 135 6.24e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194533
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a caspase-associated recruitment domain and may function in apoptosis. It has been identified as a tumor suppressor in lung and gastric cancers, and a polymorphism in the gene may be associated with gastric cancer risk. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adamtsl2 G A 2: 27,103,178 G740E probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
BC027072 A G 17: 71,749,284 S1133P probably benign Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kansl2 A G 15: 98,524,478 L403S probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Nes T A 3: 87,978,931 I1499N possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Pth2r G T 1: 65,336,769 W62L probably damaging Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
St5 T C 7: 109,557,207 D112G probably benign Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Thegl A G 5: 77,059,405 I337V possibly damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in Mindy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Mindy3 APN 2 12355272 splice site probably benign
IGL02623:Mindy3 APN 2 12364483 nonsense probably null
R0944:Mindy3 UTSW 2 12396182 missense possibly damaging 0.94
R1275:Mindy3 UTSW 2 12396173 splice site probably null
R2066:Mindy3 UTSW 2 12419249 missense probably damaging 1.00
R2357:Mindy3 UTSW 2 12404176 splice site probably benign
R3724:Mindy3 UTSW 2 12355354 missense probably damaging 0.97
R4031:Mindy3 UTSW 2 12401083 splice site probably null
R4089:Mindy3 UTSW 2 12364516 missense probably benign 0.21
R4175:Mindy3 UTSW 2 12405865 missense probably damaging 1.00
R4359:Mindy3 UTSW 2 12396209 missense probably damaging 1.00
R4424:Mindy3 UTSW 2 12348199 missense probably benign 0.00
R4640:Mindy3 UTSW 2 12348163 missense probably benign 0.01
R4931:Mindy3 UTSW 2 12396213 missense probably damaging 1.00
R5926:Mindy3 UTSW 2 12348100 missense probably damaging 1.00
R5966:Mindy3 UTSW 2 12401043 missense probably benign 0.17
R6330:Mindy3 UTSW 2 12356933 missense probably damaging 1.00
R6518:Mindy3 UTSW 2 12382129 missense probably damaging 1.00
R6587:Mindy3 UTSW 2 12348116 nonsense probably null
R6852:Mindy3 UTSW 2 12419252 start codon destroyed possibly damaging 0.53
R6961:Mindy3 UTSW 2 12396178 critical splice donor site probably null
R7103:Mindy3 UTSW 2 12401074 missense possibly damaging 0.95
R7624:Mindy3 UTSW 2 12419189 missense probably benign 0.00
R7661:Mindy3 UTSW 2 12397517 missense probably damaging 1.00
R8474:Mindy3 UTSW 2 12400028 missense probably damaging 1.00
R8518:Mindy3 UTSW 2 12355343 missense probably damaging 1.00
R9541:Mindy3 UTSW 2 12386638 missense probably damaging 1.00
R9578:Mindy3 UTSW 2 12356904 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCTTAAGAGACAGATGTAACTCC -3'
(R):5'- TTAAGCCGAGGCCTTCTTACTG -3'

Sequencing Primer
(F):5'- CTCCTTTTGTAAAAATGCACTGTC -3'
(R):5'- GAGGCCTTCTTACTGTTTCTCATGAC -3'
Posted On 2014-10-15